Cladistic analysis of Echinodorus (Alismataceae): simultaneous analysis of molecular and morphological data

Leena Myllys

The anatomical characters of the scape of Echinodorus glandulosus, E. lanceolatus, E. palaefolius, E. paniculatus, E. pubescens and E. subalatus subsp. subalatus (Alismataceae) were examined. These six sympatric species occur in northeastern Brazil and demonstrate great morphological similarity. The aim of the present study was to identify anatomical characters of taxonomic importance. Scapes possess a uniseriate epidermis composed of thin-walled tabular cells. The scapes of most species have differentiated epidermis, cortex, and vascular cylinders. There are several layers of regular chlorenchyma cells immediately below the epidermis, intercalated with collateral vascular bundles, in all species. There are also laticiferous ducts throughout the scape, and aerenchyma in both the cortex and pith. The shape and outline of scapes, the presence and position of winged extensions, the absence of differentiated vascular cylinders or cortex, and the number of vascular bundles are important ...

This study focuses on some structural features noticed in Alisma plantago-aquatica. With plant material collected from Bugeac Lake (Dobrudja), the morphological analysis of water-plantain’s vegetative organs is reported herein. In our survey, cross-sections were performed throughout the stem and stalk. Also, we examined the literature knowledge on A. plantago-aquatica, in terms of importance and adaptative changes of this perennial plant to wetland ecosystems highlighted by characteristics of leaves and root system.

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/229970061 Cladistic analysis of Echinodorus (Alismataceae): Simultaneous analysis of molecular and morphological data ARTICLE in CLADISTICS · OCTOBER 2007 Impact Factor: 6.22 · DOI: 10.1111/j.1096-0031.2007.00177.x CITATIONS READS 18 120 2 AUTHORS: Samuli Lehtonen Leena Myllys 27 PUBLICATIONS 199 CITATIONS 49 PUBLICATIONS 891 CITATIONS University of Turku SEE PROFILE All in-text references underlined in blue are linked to publications on ResearchGate, letting you access and read them immediately. University of Helsinki SEE PROFILE Available from: Samuli Lehtonen Retrieved on: 04 February 2016 Cladistics Cladistics 24 (2008) 218–239 10.1111/j.1096-0031.2007.00177.x Cladistic analysis of Echinodorus (Alismataceae): simultaneous analysis of molecular and morphological data Samuli Lehtonen1* and Leena Myllys2 1 Department of Biology, Section of Biodiversity and Environmental Science, University of Turku, FI-20014 Turku, Finland; 2Botanical Museum, Finnish Museum of Natural History, PO Box 7, FI-00014 University of Helsinki, Finland Accepted 8 May 2007 Abstract Echinodorus is the second largest genus in the aquatic plant family Alismataceae. The genus is naturally distributed in the New World, but many species are known world-wide as popular aquarium plants. The views upon species delimitation and infrageneric classiﬁcation of the genus have been controversial. Phenotypic plasticity of aquatic plants combined with reduced and presumably convergent morphological structures pose serious problems to classiﬁcation, emphasizing the need for molecular-level data. A simultaneous cladistic analysis of molecular and morphological data was conducted to resolve the phylogeny of the genus. The results showed Echinodorus (as it is currently circumscribed) to be polyphyletic. None of the currently proposed infrageneric classiﬁcations of the genus were supported in the light of phylogenetic evidence. Also, many species and subspecies level rankings were found to be unnatural. Monophyly of Echinodorus is ascertained by separating Helanthium and the monotypic genus Albidella from Echinodorus. As a result, two new combinations (Helanthium bolivianum and H. zombiense) are made, and a detailed description of the genus Helanthium is provided. The Willi Hennig Society 2007. Monocot phylogenetics has received great interest over the last years (Soltis et al., 2005). Within monocots, the Alismatales represent one of the oldest lineages and they therefore have a central role in the study of character evolution of the whole group (Soltis et al., 2005). Aquatic monocots are of special interest, as a longstanding hypothesis favors an aquatic origin for this major group of angiosperms (Les and Schneider, 1995). Within Alismatales Judd et al. (2002) recognized a large ‘‘aquatic clade’’ (Alismataceae, Aponogetonaceae, Butomaceae, Cymodoceaceae, Hydrocharitaceae, Juncaginaceae, Limnocharitaceae, Posidoniaceae, Potamogetonaceae, Ruppiaceae, Scheuchzeriaceae and Zosteraceae). This large clade was further subdivided in two, and the smaller subclade includes Alismataceae ( 80 species and 12 genera), Butomaceae (monospeciﬁc), Hydrocharitaceae (> 100 species in 18 genera), Limnocharitaceae (seven species in three genera) and *Corresponding author: E-mail address: samile@utu.ﬁ The Willi Hennig Society 2007 Najadaceae ( 40 species in one genus) (Les and Haynes, 1995; Les et al., 1997; Chen et al., 2004). Some studies have resolved Limnocharitaceae nested within Alismataceae (Les et al., 1997; Chen et al., 2004), while other studies suggest that they are sister lineages (e.g., Petersen et al., 2006). Butomaceae has been constantly resolved as sister to Hydrocharitaceae–Najadaceae clade, together they seem to be a sister to Alismataceae– Limnocharitaceae clade (Les and Haynes, 1995; Les et al., 1997; Chen et al., 2004). Alismataceae phylogenetics and taxonomy have remained poorly understood, largely because of morphological reductions and presumed convergent adaptations in aquatic habitats (Les and Haynes, 1995). Most phylogenetic studies of the group (Les et al., 1997; Chen et al., 2004; Petersen et al., 2006) have concentrated on higher level taxonomy, and taxon sampling within Alismataceae have been insuﬃcient to test the monophyly of the genera, or to study genus or species-level relationships. The two largest genera (Echinodorus Rich. ex Engelm., Sagittaria L.) comprises more than half of S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 the species in the family, and only few species are included in each of the remaining 10 genera. However, especially the boundaries between Echinodorus, Baldellia Parl., Caldesia Parl., Luronium Raf. and Ranalisma Stapf are considered to be poorly deﬁned (Cook, 1990). Therefore it is highly important to understand the phylogenetics of genus Echinodorus. This genus includes 26 species (up to 62 according to Rataj, 2004), and its center of diversity lies in South America (Haynes and Holm-Nielsen, 1994). Echinodorus is widely known because of its worldwide importance in the ornamental aquarium plant trade (Haynes and Holm-Nielsen, 1994; Kasselmann, 2003; Lehtonen and Rodrı́guez Arévalo, 2005). In recent years several revisions of the genus have been published, with controversial views upon species delimitation and infrageneric classiﬁcation (Rataj, 1975; Haynes and Holm-Nielsen, 1994; Lot and Novelo, 1994; Rataj, 2004). Rataj (1975, 2004) has used both subgeneric and sectional ranks below genus, while Haynes and Holm-Nielsen (1994) rejected Rataj’s sections, but accepted subgenera Echinodorus and Helanthium, the latter often misspelled as Helianthium (see Pichon, 1946). However, none of the existing revisions have included any phylogenetic analyses, and therefore it is not surprising that several problems in existing classiﬁcations were discovered in a recent morphology-based phylogenetic analysis of the genus (Lehtonen, 2006). In this analysis Echinodorus was found paraphyletic, as the pseudostoloniferous species of the subgenus Helanthium were not placed in monophyletic Echinodorus sensu stricto (Lehtonen, 2006). Albidella nymphaeifolia was resolved as a basal member of the subgenus Echinodorus, although Fassett (1955), Rataj (1975, 2004), and Haynes and Holm-Nielsen (1994) classiﬁed it in subgenus Helanthium. Furthermore, the analysis rejected practically all of the sections proposed by Rataj (1975, 2004), and also questioned some synonymies made by Haynes and Holm-Nielsen (1986). In this study our main goal is to investigate the phylogenetic relationships in Echinodorus by a simultaneous analysis (Nixon and Carpenter, 1996) of morphological and molecular characters. New DNA sequence data are added to the morphological data set modiﬁed from Lehtonen (2006) in order to unambiguously resolve both the phylogeny of the genus and the existing controversy in its taxonomy. Taxon sampling is expanded by adding several new outgroup terminals. Materials and methods Taxon sampling and classification adopted Most of the material used for DNA sequencing in this study was collected from natural populations growing in 219 Argentina, Bolivia, Ecuador, Mexico, Paraguay, Peru, Uruguay and Venezuela by the senior author together with ﬁeld assistants. Some material was collected and kindly provided for the study by colleagues traveling in other countries. Herbarium material was used when species were not found in the ﬁeld. Few taxa were collected from cultivated populations, but as hybrids are common in cultivation (Kasselmann, 2003), the purity of these taxa cannot be guaranteed. Ten taxa were coded only for the morphological data matrix, because no molecular data could be obtained (Appendix 1). Although we believe that classiﬁcation (including species delimitation) should be the result of an analysis instead of given a priori, we had to limit DNA isolation and sequencing to some individuals due to economical reasons. However, we tried to cover both the morphological and geographic variation in Echinodorus as widely as possible by selecting 50 specimens (including Albidella and Helanthium) of distinct populations for molecular studies (Appendix 1). These populations are used here as terminals instead of a priori delimited species, and therefore also the morphological data are coded for every sampled population. We identiﬁed and named the studied plants mainly according to Haynes and Holm-Nielsen (1994). Under this classiﬁcation our molecular data represent 19 recognized species, but in some cases groups of morphologically united specimens did not match any species diagnosis of Haynes and Holm-Nielsen (1994) or others (Micheli, 1881; Fassett, 1955; Rataj, 1975, 2004). These taxa are treated as unnamed species (sp1, sp2, sp3, sp4). Haynes and Holm-Nielsen (1986, 1994) treated E. longiscapus and E. grandiflorus as E. grandiflorus ssp. grandiflorus and E. floribundus as E. grandiflorus ssp. aureus. This classiﬁcation is in conﬂict with Rataj’s (1969; 1975, 2004) opinion and it was also challenged by the morphological analysis (Lehtonen, 2006). Similarly, Rataj (1967, 1970, 1975) described species E. gracilis, E. osiris and E. cylindricus, which were later synonymized with E. grisebachii, E. uruguayensis and E. paniculatus, respectively, by Haynes and Holm-Nielsen (1994). On the other hand, Holm-Nielsen and Haynes (1985) described the species E. eglandulosus, which was not accepted as a separate species by Rataj (2004). Echinodorus ovalis was described by Sauvalle (1870), but considered as a synonym of E. cordifolius ssp. cordifolius by Haynes and HolmNielsen (1986, 1994). In these cases we determined our terminals using the narrow concept in order to test the contradicting classiﬁcations. In general, however, we tried not to strictly follow any existing classiﬁcation, but to achieve a reliable basis for one. We included several representatives of the other genera of Alismataceae (Alisma, Baldellia, Caldesia, Ranalisma, Sagittaria, Wiesneria Micheli) and one species of Limnocharitaceae to test the monophyly of Echinodorus. Butomus umbellatus (Butomaceae) served 220 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 as an outgroup species for the analyses. Although it is not clear whether Alismataceae and Limnocharitaceae should be considered a single family, they clearly form a clade. We consider Butomus to be an appropriate outgroup because of its basal position in the sister lineage of Alismataceae–Limnocharitaceae clade (Les and Haynes, 1995; Les et al., 1997; Chen et al., 2004). Our collections concentrated on Echinodorus, and most sequences for outgroup terminals were obtained from GenBank. Unfortunately most of the Alismataceae genera are still today very poorly sampled. ITS sequences were available for a variety of Alismataceae species, and matK sequences for a couple of taxa, but otherwise useful sequences were not available. Missing data may cause problems for phylogenetic analyses, but the same is also true regarding insuﬃcient taxon sampling (Zwickl and Hillis, 2002). Wiens (2006) recently revisited the eﬀect of missing data and concluded that even highly incomplete taxa may improve the accuracy of the analysis. Encouraged by these ﬁndings we included in our analyses some taxa with ITS sequences and morphological data only. As a result, we coded 70 terminals for the total-evidence analysis. DNA isolation, amplification and sequencing Four DNA regions representing both nuclear and chloroplast genomes were selected for sequencing, as they have proved to have high substitution rates in previous phylogenetic studies (Cox et al., 1992; Baldwin et al., 1995; Hilu and Liang, 1997; Grob et al., 2004). The matK region was sequenced from the chloroplast genome, and the second intron of LEAFY, 5S nontranscribed region (5S-NTS), and internal transcribed spacer regions (ITS1;2), including 5.8S gene were sequenced from the nuclear genome. The matK region has been commonly used and recommended for phylogenetic studies because of its rapid evolution (Soltis and Soltis, 1998; Hilu et al., 2003). Similarly, ITS has been widely used (Soltis and Soltis, 1998), and studies where the second intron of LEAFY gene has been used have revealed great potential especially in lower-level phylogenies due to its high substitution rate and unproblematic ampliﬁcation (Oh and Potter, 2003; Grob et al., 2004). 5S-NTS is a rapidly evolving locus and therefore useful in studies of closely related species (Sastri et al., 1992; Persson, 2000; Becerra, 2003; Lindqvist et al., 2003). Total genomic DNA was extracted from silica-dried material by using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA) and following the instructions of the manufacturer. For herbarium samples, however, we used the modiﬁed protocol (30 min incubation, 450 lL of AP1, 50 lL of AE, 10 min elution) by Drábková et al. (2002). The matK gene was ampliﬁed using two external primers, MG1 and MG15 (Table 1). The following polymerase chain reaction (PCR) proﬁle was used: initial incubation at 95 C for 2 min, followed by 30 cycles of 1 min at 95 C, 1 min at 60 C and 1 min at 72 C. The cycle ended with a 7 min extension at 72 C. Fragments were puriﬁed with the QIAquick PCR puriﬁcation kit (Qiagen) or with the E.Z.N.A. Cycle-Pure Kit (Omega Bio-tek, Doraville, GA). Four internal primers were used in sequencing: matK-EF, matK-E1F, matK-8R and matK-ER (Table 1, Fig. 1). ITS1 and ITS2 regions were ampliﬁed and sequenced together with 5.8S gene by using primers ITS5, and ITS4 or ITS-ER (Table 1). The PCR proﬁle and fragment puriﬁcation were similar to those of matK. Universal primers for ITS (ITS5 and ITS4) gave multiple bands on agarose gel for some taxa. To avoid this problem we designed a more speciﬁc primer (ITS-ER) that allowed us to get a clear single band in most cases. This primer failed in certain taxa (Sagittaria, Alisma, Caldesia and Helanthium), but in these cases ITS4 produced only one band and it was used instead. Table 1 Primers used in PCR and sequencing Primer Sequence 5¢ ﬁ 3¢ Reference MG1* MG15* matK-EF matK-E1F matK-8R matK-ER ITS5 ITS4 ITS-ER FLint2-F1 FLint2-R1 PI PII CTACTGCAGAACTAGTCGGATGGAGTAGAT ATCTGGGTTGCTAACTCAATG GAAGAATTCCAAAARGATTT ATTGCGATTTTTTCTATACGA AAAGTTCTAGCACAAGAAAGTCGA TCCTTGATATCGAACATAATG GGAAGTAAAAGTCGTAACAAGG TCCTCCGCTTATTGATATGC ATGCTTAAACTCRGCGGGTGA CTTCCACCTCTACGACCAGTG TCTTGGGCTTGTTGATGTAGC TGGGAAGTCCTYGTGTTGCA KTMGYGCTGGTATGATCGCA Liang and Hilu (1996) Liang and Hilu (1996) Present paper Present paper Ooi et al. (1995) Present paper White et al. (1990) White et al. (1990) Present paper Grob et al. (2004) Grob et al. (2004) Cox et al. (1992) Cox et al. (1992) *Used only as PCR primers. Used only as sequencing primers. S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 mat K-EF mat K-E1F trn K(3’) mat K trn K(5’) mat K-ER mat K-8R 0 1 kb Fig. 1. Relative position of the primers used for sequencing matK in this study. The second intron of LEAFY gene was ampliﬁed and sequenced using two external primers, FLint2-F1 and FLint2-R1 (Table 1). The PCR proﬁle and fragment puriﬁcation were similar to matK and ITS, except that 35 cycles were ran in PCR. Primers used for 5S-NTS ampliﬁcation and sequencing were PI and PII (Table 1). Numerous copies of 5S-NTS are present in plant genome, thus resulting in possibly incorrect statements of homology (Bailey et al., 2003). The pattern of DNA fragments run in agarose gel varied somewhat between groups of species and we cannot be certain that all sequenced fragments are actually truly orthologous. The PCR proﬁle used for 5S-NTS was the same as for LEAFY, but fragments were run in 1% agarose gel and a single band was cut for puriﬁcation by using the QIAquick Gel Extraction Kit (Qiagen). We ampliﬁed the DNA in 25 lL reactions on a GeneAmp PCR System 9700. The reaction mixture contained Puretaq RTG PCR bead (Amersham Biosciences, Piscataway, NJ), 1 lL of each primer, 6 lL of DNA template, and 17 lL of ddH2O. Sequencing was performed by using the BigDye Terminators v3.1 Cycle Sequencing Kit in an Applied Biosystems (AB) ABI PRISM 377-XL DNA Sequencer (Applied Biosystems, Foster City, CA). The accuracy of sequences was ensured by sequencing and comparing the studied DNA regions in both directions; remaining ambiguities were coded using IUPAC ambiguity codes. Voucher specimens of the new sequences are deposited at TUR, UNA or AAU, and sequences in GenBank (Appendix 1). Morphological data Morphological characters from Lehtonen (2006) were partly recoded and supplemented with some new data and thus included 86 characters (Appendices 2 and 3). Coding is based on the study of both living plants in their natural habitats and herbarium specimens deposited in AAU, AMAZ, BM, FCQ, H, K, LPB, M, MEXU, MVJB, NY, QCA, QCNE, SI, TUR, U, UC, UNA and VEN (Appendix 4; herbarium acronyms according to Holmgren and Holmgren, 1998). The analysis by Lehtonen (2006) was partly based on continuous overlapping characters, which were shown to be responsible for the ﬁner-scale resolution in the resulting cladogram. In this study continuous data could 221 not be used, as we analyzed our data with POY (Gladstein and Wheeler, 2001), which does not support the coding method used by Lehtonen (2006) as implemented in the program TNT (Goloboﬀ et al., 2003). Many of these continuous characters were too variable to be recoded into discrete states in any reasonable way and were thus omitted. Others were recoded by using discontinuities as separation points for discrete character states. However, this led to some character states with wide variation. Characters were equally weighted, and they were coded as non-additive. Phylogenetic analyses We based our study on the concept of dynamic homology (Wheeler, 1996, 2001) by using direct optimization as implemented in POY (Gladstein and Wheeler, 2001). Sequences were initially aligned with ClustalX (Thompson et al., 1997) using default parameters. Based on these alignments we divided both ITS and LEAFY sequences into three separate data partitions (ITS1, 5.8S, ITS2 and exon 2, intron 2, exon 3, respectively) to accelerate direct optimization (Giribet, 2001). This partition was done within regions that did not show variation between terminals. After data partitioning the gaps were removed and unaligned sequences were submitted to phylogenetic analyses. The analyses were performed for ﬁve data combinations: morphology alone, chloroplast sequence alone (matK), nuclear sequences combined (ITS, LEAFY and 5S-NTS), all molecular data combined, and combined total-evidence analysis of molecular and morphological data. Transitions, transversions and indels were given the same weight. Bremer support values (Bremer, 1988) were calculated for each data combination. Morphological data were analyzed with TNT (Goloboﬀ et al., 2003), whereas molecular data and total-evidence analysis were analyzed with POY (Gladstein and Wheeler, 2001). The TNT-analysis was performed with 10 000 replicates, and by saving ﬁve trees per replicate. The command line used in the POY-analyses is given in Appendix 5. POY analyses were run in a parallel environment of eight processors of the IBMSC cluster in the CSC, the Finnish IT Center for Science. In order to evaluate possible incongruence between diﬀerent data sets and previously published results we calculated the minimum number of SPR moves required to convert a tree obtained from one data set into the other tree obtained from diﬀerent data set, and corresponding tree-similarity measurements (100 sequences with ﬁve levels of stratiﬁcation used throughout the analyses) (Goloboﬀ et al., 2003). These minimum numbers of SPR moves were compared with moves required when 1000 pairs of random trees of equal number of terminals were compared. SPR moves were calculated 222 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 with TNT (Goloboﬀ et al., 2003), and a simple script was used for random tree comparisons (loop 1 + 1 1000, rseed*, randtrees 2 0 0, sprdiﬀ 0 1100 · 5, stop). Results Morphological data Our morphological data yielded 1368 trees of 458 steps. The strict consensus tree (Fig. 2) is poorly resolved. Phylogenetic relationships of most Alismataceae genera remain unresolved, but Helanthium is resolved as a separate clade from Echinodorus. Albidella nymphaeifolia is sister to Echinodorus, and E. berteroi is sister to the rest of Echinodorus. Most groupings within Echinodorus are composed of populations of single species, but the species-level relationships are mostly unresolved. Nevertheless, E. reticulatus, E. longipetalus, E. horizontalis and E. tunicatus form a clade that is resolved with similar topology based on molecular data sets as well (note that no molecular data were available from E. reticulatus, but based on morphology its status as a species separate from E. longipetalus is highly questionable). This species group was placed in a clade together with several other species, including sp2, E. uruguayensis–E. osiris group, and a clade of E. major, E. trialatus, and E. grisebachii group. However, Bremer support values for these species-level groupings are mostly very low. The number of SPR moves required to change the obtained tree into matK or total-evidence tree is equally low (Table 2), but a few more moves are needed for nuclear DNA tree. Nuclear data The combined analysis of nuclear DNA data resulted in three equally parsimonious optimizations with a length of 3106 steps (Fig. 4). Albidella is resolved as a basal lineage in Alismataceae, and it is followed by the Wiesneria–Sagittaria clade. Interestingly, the Alisma–Baldellia clade separates E. berteroi from the main bulk of Echinodorus. Otherwise the topology in the main group of Echinodorus is congruent with the matK tree, only the positions of the E. bracteatus and E. grisebachii are changed. The large clade that remained unresolved in matK analysis is almost fully resolved by nuclear data, but in many cases populations belonging in separate species are mixed with each other. Combined DNA analysis The combined analysis of all molecular data resulted in three equally parsimonious optimizations with a length of 3956 steps, but a one-step shorter tree (3955 steps) was found during the Bremer support calculations (Fig. 5). The topology of the tree is mostly similar to the nuclear DNA topology, with the following exceptions: E. berteroi is resolved as a basal species in Echinodorus sensu stricto, the resolution in E. major (incorrectly named as E. martii in Haynes and Holm-Nielsen, 1994) and E. grisebachii clades is slightly changed, as well as the topology in the large E. cordifolius clade. The optimal combined DNA tree requires six SPR moves to be converted into nuclear DNA tree, or seven to be converted into matK tree (Table 2). Twelve SPR moves are required to convert the tree into morphology-based tree. Chloroplast data Total evidence of molecular and morphological data The analysis of matK data resulted in 12 equally parsimonious optimizations (trees) with a length of 829 steps (consensus tree represented in Fig. 3). Alisma is resolved as a basal species of the family, and Limnocharis is nested within Alismataceae. In this analysis Helanthium was resolved as a clade separate from Albidella and Echinodorus. Caldesia is a sister to Sagittaria, and this clade is a sister lineage to Echinodorus–Albidella clade. Echinodorus berteroi is resolved as a basal species of Echinodorus, and Albidella is nested within Echinodorus sensu stricto. Several clades are recognized in Echinodorus sensu stricto, the largest one without much internal resolution. The relatively derived position of E. grisebachii contradicts its placement in other analyses, but its position in the matK tree is poorly supported based on Bremer values. Eight SPR moves are needed to convert the matK tree into morphological, nuclear, or total-evidence tree (Table 2). Simultaneous analysis of all molecular and morphological data resulted in a single parsimonious optimization of 4541 steps (Fig. 6). Echinodorus sensu lato is a polyphyletic group, as Albidella is resolved in a basal position to the family, Helanthium as a sister to Ranalisma, and Echinodorus sensu stricto is a separate clade. Limnocharis was resolved as a sister to Caldesia based on DNA, but this position changed in the simultaneous analysis, and Limnocharis is resolved within Wiesneria–Sagittaria clade. Within Echinodorus the topology diﬀers only slightly from the topology of combined DNA analysis. Populations of E. floribundus, E. longiscapus, E. cordifolius, E. ovalis, sp1, sp3 and sp4 were mixed with each other in the combined DNA analysis, but when morphological data are included they form clades that correspond well with generally recognized taxa. Similarly, E. heikobleheri and E. gracilis are grouped within E. grisebachii in the S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 Fig. 2. Strict consensus tree of 1368 trees based on morphological characters. Bremer support values are indicated below branches. 223 224 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 Table 2 The minimum number of SPR moves required to convert a tree into another. The upper diagonal shows the number of SPR moves needed to convert trees obtained in this study, and the similarity measures. Lower diagonal shows the number of SPR moves expected on the basis of 1000 random tree pair comparisons with the same number of terminals Morphology matK Nuclear DNA Total DNA Total evidence Morphology matK Nuclear DNA Total DNA Total evidence – 45–47 57 58 68 8 (0.8824) – 45–47 45–47 45–47 11 (0.8382) 8 (0.8824) – 57 57 12 (0.8824) 7 (0.8824) 6 (0.8824) – 58 8 8 8 7 – Fig. 3. Strict consensus tree of 12 trees based on the matK DNA analysis. Bremer support values are indicated below branches. (0.8824) (0.8824) (0.8824) (0.8971) S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 225 Fig. 4. Strict consensus tree of three trees based on the nuclear DNA analysis. Bremer support values are indicated below branches. combined DNA analysis, but based on total evidence E. heikobleheri is sister to E. gracilis–E. grisebachii group. Seven or eight SPR moves are required to change the total-evidence tree into any other tree produced in our analyses (Table 2), compared with 68 moves expected for random trees. However, when we transformed our total-evidence tree into the previously published tree that was based on discrete and continuous morphological characters (Lehtonen, 2006), a total of 15 SPR moves (similarity 0.5833) were required (29–33 moves expected on the basis of 1000 random tree pairs). Considerably more moves (21 SPR moves, similarity 0.4167) were required to convert the tree for continuous data (Lehtonen, 2006) into our total-evidence tree. 226 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 Fig. 5. Shortest tree found in a combined analysis of all molecular data. Bremer support values are indicated below branches. Discussion Comparison with previous studies The phylogenetic analyses of Alismataceae made by Les et al. (1997) and Chen et al. (2004) were based on rbcL sequence only, but included representatives from over a half of the genera. Both analyses resolved Limnocharis together with Hydrocleys within Alismataceae (Les et al., 1997; Chen et al., 2004). Our analyses did not include Hydrocleys, but Limnocharis was placed within Alismataceae. However, we were unable to sequence nuclear DNA of Limnocharis. Furthermore, our analyses of diﬀerent data sets resulted in varying topologies at the deeper phylogenetic level, and the total-evidence tree is incongruent with the published rbcL (Les et al., 1997; Chen et al., 2004) and mitochondrial (Petersen et al., 2006) phylogenies. Therefore we advocate further studies with emphasis on wider taxon and character sampling in currently recognized S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 227 Fig. 6. Shortest tree found in the total-evidence analysis. Bremer support values are indicated below branches. Alismataceae and Limnocharitaceae to resolve their ambiguous relationship. However, our main goal in this study was not to investigate phylogenetics of the whole Alismataceae, but to concentrate in lower-level phylogenetic patterns within one of the largest genus of the family, Echinodorus. The phylogeny obtained here diﬀers in many respects from the results of a previous analysis that was based on morphology (Lehtonen, 2006), but has some common features as well. The basal position of E. berteroi in Echinodorus sensu stricto is supported both in our total-evidence and in prior morphology-based analysis. Echinodorus longipetalus group is also resolved in the same way in the two analyses, but the phylogenetic position of the group is diﬀerent. Close relations of many species hypothesized in the previous morphology-based 228 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 study (Lehtonen, 2006) are further conﬁrmed here, although some other species are resolved in a totally diﬀerent position. Echinodorus as circumscribed by Fassett (1955) and later workers (Rataj, 1975; Haynes and Holm-Nielsen, 1994; Haynes and Hellquist, 2000; Rataj, 2004) is clearly a polyphyletic combination of three groups. On the other hand, the classiﬁcation proposed by Pichon (1946) corresponds well with the phylogeny obtained in this study. In this classiﬁcation Albidella nymphaeifolia forms a monotypic genus, and Helanthium and Echinodorus are independent genera. Several morphological characters distinguish these genera: the broadly paniculate compound inﬂorescence and crested fruits of Albidella are distinct from Echinodorus and Helanthium. Helanthium, on the other hand, has turgid fruits and it is the only pseudostoloniferous Alismataceae genus in the New World. Within Echinodorus the most distinct species E. berteroi diﬀers from the other species by its clawed petals and fruits, which are two-keeled. New combinations in Helanthium Based on our results, Helanthium is sister to the Old World genus Ranalisma. Both Helanthium and Ranalisma have pseudostolons, which are inﬂorescences modiﬁed for vegetative reproduction under submerged conditions (Charlton, 1999). On the other hand, Ranalisma has quite distinctive fruits and fruiting heads, and a closer examination of the ITS sequences revealed remarkable diﬀerences when compared with Helanthium sequences. For these reasons we are not combining Helanthium and Ranalisma, but in order to achieve a monophyletic circumscription of Echinodorus we have to accept Helanthium as a genus of its own. A detailed description of the genus Helanthium is given below. Annuals or short-lived perennials, glabrous, scapose, pseudostoloniferous aquatic or semiaquatic plants. Leaves as basal rosette, erect, ascending or ﬂoating; emersed leaves petiolate, blades narrow to elliptic, one to three ribbed, with pellucid markings absent or present as lines, the margins entire, the apex acute to acuminate, the base attenuate; submersed leaves sessile phyllodes, the blades linear. Inﬂorescence erect to creeping, umbelliform or racemose of two to three whorls, vegetatively proliferating or transformed to pseudostolon in submerged conditions, bracts deltoid. Flowers perfect, pedicellate; pedicels spreading in fruit; sepals 3, erect; petals 3, clawed, white, larger than sepals; stamens (6–)9, the anthers short, basiﬁxed, the ﬁlaments glabrous; carpels 10–20, separate, each with one ovule. Fruits achenes in a loose head, turgid, obovate, 3–4-ribbed, without keel, without glands, beaked, the beak erect. Type species: Helanthium tenellum (Martius) Britton Basionym: Alisma tenellum Martius in: Schultes, J.A., Schultes, J.H. (Eds.), Syst. Veg. 7, 1600. 1830. Type: Brazil, Minas Gerais, Martius s.n. (lectotype M!; selected by Rataj, 1975). The following new combinations are proposed here: Helanthium bolivianum (Rusby) Lehtonen & Myllys comb. nov. Basionym: Alisma boliviana Rusby, Mem. New York Bot. Gard. 7, 208. 1927. Type: Bolivia, Reyes, October 25, 1921. White 1540 (lectotype NY [photograph in AAU!]; isolectotypes GH, K, NY, US [digital image!]; selected by Haynes and Holm-Nielsen, 1994). Helanthium zombiense (Jérémie) Lehtonen & Myllys comb. nov. Basionym: Echinodorus zombiensis Jérémie, Adansonia 23, 192. 2001. Type: Guadeloupe, Basse-Terre, NE Trois Rivières, Étang Zombis, 420 m, June 15, 1994. Je´re´mie 1989 (holotype P). Taxonomy and classiﬁcation have been even more controversial in genus Helanthium than in Echinodorus sensu stricto. Fassett (1955) recognized four species in the group, but Rataj (2004) listed nine species. Haynes and Holm-Nielsen (1994) accepted only two polymorphic and widely distributed species, H. tenellum and H. bolivianum. Jérémie et al. (2001) did not accept this segregation and treated H. tenellum and H. bolivianum as one species, but they described a new species H. zombiense from Guadeloupe. Our phylogenetic analyses do not support the conclusions made by Jérémie et al. (2001), but if H. zombiense is understood to be conspeciﬁc with H. bolivianum the obtained phylogeny corresponds with the classiﬁcation proposed by Haynes and Holm-Nielsen (1994). However, we believe that the variation within the clade comprising H. bolivianum and H. zombiense is great enough for accepting more than just one species. If this view is accepted, H. bolivianum is paraphyletic and thus should be split further. Haynes and Holm-Nielsen (1994) listed 10 heterotypic synonyms under H. bolivianum, but unfortunately none of the plants in the population represented by our terminal H. cf. bolivianum 1 were ﬂowering, making it practically impossible to match the terminal with any proposed name, or to decide whether it is yet undescribed. Therefore we are not able to verify the correct name for the specimen and more thorough sampling is needed before a reliable taxonomy of this morphologically highly plastic genus can be achieved. Phylogenetic position of Echinodorus berteroi Echinodorus berteroi seems to be quite distantly related to the other species of the genus. This species S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 was resolved as a sister to the rest of the genus in the chloroplast DNA, combined DNA and total-evidence analyses, but in the nuclear DNA analysis Alisma– Baldellia clade was placed between E. berteroi and other Echinodorus. As Small (1909) selected E. berteroi as the type species of the genus, its phylogenetic position determines the generic name of rest of the species. If E. berteroi does not form a monophyletic group with the rest of the Echinodorus, most of the species traditionally classiﬁed as Echinodorus will need a new generic name. However, we consider our total-evidence analysis to be the most reliable hypothesis of the phylogenetic relationships for Echinodorus available at the moment, and therefore we consider the monophyletic clade with E. berteroi as a basal species to represent a single genus, Echinodorus. Other taxonomic implications Rataj (1975, 2004) divided the genus Echinodorus (as circumscribed here) into nine sections. With the exception of sections Berteroii and Uruguayensii none of the sections appear to be monophyletic. Even though several clades are recognized within Echinodorus, we cannot see any reason for formal subdivision of the genus, especially because morphological characters are widely overlapping between the clades. Thus, we follow Haynes and Holm-Nielsen (1994) and reject all proposed sections. Our study throws light on the many existing problems in Echinodorus classiﬁcation. Echinodorus decumbens is resolved together with E. subalatus ssp. subalatus and E. subalatus ssp. andrieuxii, but we lack molecular data from E. subalatus ssp. subalatus. The two subspecies of E. macrophyllus are resolved as two distinct lineages suggesting that they should be recognized as separate species. Echinodorus grisebachii, E. gracilis, E. eglandulosus and E. heikobleheri are mixed in one clade with varying topology and position in phylogeny depending on the data set. Echinodorus cylindricus is not grouped together with E. paniculatus as Haynes and Holm-Nielsen (1994) suggested, but as a sister to E. glaucus (E. teretoscapus). Echinodorus osiris is nested within two populations of E. uruguayensis and apparently should be considered to be conspeciﬁc (as done by Haynes and Holm-Nielsen, 1994). Echinodorus ovalis is nested within E. cordifolius, and also the subspeciﬁc classiﬁcation of E. cordifolius seems unnatural. Species delimitation in the E. grandiflorus complex has been controversial (Rataj, 1969; Haynes and HolmNielsen, 1986). While Haynes and Holm-Nielsen (1986, 1994) recognized only one species (E. grandiflorus) with two subspecies, and Haynes and Burkhalter (1998) two species (E. grandiflorus and E. floridanus), Rataj (1969, 1975, 2004) has accepted E. floribundus, E. grandiflorus and E. longiscapus as separate species (although he used 229 incorrect names for two of them: E. grandiflorus for E. floribundus, and E. argentinensis for E. grandiflorus). These taxa formed a clade in the total-evidence analysis, but not in the DNA-based analyses or in the previous morphology-based analysis (Lehtonen, 2006). Therefore it seems reasonable to recognize E. floribundus (E. grandiflorus ssp. aureus sensu Haynes and HolmNielsen, 1986) at the species level. Echinodorus grandiflorus, E. longiscapus and E. floridanus form a monophyletic group of two morphologically distinctive subgroups. Haynes and HolmNielsen (1986, 1994) treated E. grandiflorus and E. longiscapus as E. grandiflorus ssp. grandiflorus, and later Haynes and Burkhalter (1998) described E. floridanus as a distinct species. This classiﬁcation seems incorrect, and due to the lack of any molecular or morphological diﬀerences between E. grandiflorus and E. floridanus they should not be recognized as separate species. Echinodorus grandiflorus–E. floridanus group is resolved monophyletic in every separate analysis, except in chloroplast analysis where the resolution is poor at that level. Echinodorus longiscapus group is also mostly resolved in separate analyses. Molecular evidence together with morphological and ecological diﬀerences (E. grandiflorus occurs along rivers in coastal areas, while E. longiscapus is widely distributed in temporary pools of standing water on savannas) indicates the existence of two separate species (E. longiscapus and E. grandiflorus) instead of one subspecies (E. grandiflorus ssp. grandiflorus). The four morphologically distinct populations, sp1, sp2, sp3 and sp4 could not be identiﬁed as members of any described species. Sp1 is resolved as a sister to E. uruguayensis, but they are clearly distinguishable both on molecular and morphological level. Several morphologically similar populations of sp1 are known from Paraguay, North Argentina and South Brazil, and they seem to represent an undescribed species. Two populations of sp2 (one from Peru and another from Bolivia) are resolved as a sister group to E. macrophyllus ssp. scaber. The sister group position of these lineages is clearly supported by all data, but the lineages can be separated by diﬀerent ﬂower and fruit morphology, and by diﬀerences in ITS and 5S-NTS sequences. They also diﬀer biogeographically (sp2 present in western Amazonia, E. macrophyllus ssp. scaber in central Brazil and northern South America) and therefore, sp2 most probably represents an undescribed species as well. Sp3 was collected from western Paraguay and it is morphologically quite distinct from the other species. However, as only one small population growing in an unusual habitat for the group (large plants were growing submerged in ﬂowing stream) was found, it is not clear whether it represents species of its own, or just extreme phenotypic plasticity of some other species. Sp3 is resolved as a distinct lineage in the total-evidence 230 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 analysis, but sequence data do not provide a clear picture and the position in the total-evidence analysis may be confounded by the unusual morphology caused by submerged growth. Sp4 was collected from the Chaco region in Paraguay, and it has a mixture of morphological characters of E. longiscapus and E. floribundus with a unique character state, a creeping inﬂorescence. In the matK tree this specimen is grouped together with one E. longiscapus specimen, but nuclear DNA gives contradicting results. Morphological and molecular evidence Morphology-based studies of aquatic plants encounter many diﬃculties due to the plasticity, reduced structures and presumed convergence (Sculthorpe, 1967; Björkqvist, 1968; Wooten, 1986; Les and Haynes, 1995), and this may explain the contradicting results between the morphology-based (Lehtonen, 2006) and combined studies. In order to overcome limitations in morphological data the use of supporting molecularlevel data is thus highly desirable. On the other hand, relatively small data sets in molecular systematics have repeatedly produced phylogenies contradicting old classiﬁcations, and the need for a wide character sampling is generally acknowledged (Doyle, 1992; Soltis et al., 2005). Our study supports these conclusions: phylogenies based on single genes should be considered cautiously, and it may be wise not to make dramatic changes in existing classiﬁcations without further sampling. In this study we used various loci from chloroplast and nuclear genomes. Separate analysis of these two genomes resulted in topologies with incongruence at the deeper phylogenetic level. This may be due to the fact that taxon sampling has been recognized to play a crucial part in the phylogenetic inference (e.g., Rydin and Källersjö, 2002; Zwickl and Hillis, 2002) and in our study outgroup sampling varied between the analyses: we had much more outgroup taxa in the nuclear genome analysis. In addition, we had taxa with a high amount of missing data in the total-evidence analysis as we lacked LEAFY and 5S-NTS sequences of most outgroup taxa. Although incomplete taxa may have a positive inﬂuence on phylogeny reconstruction by cutting long branches it is still possible that the negative eﬀects overcome these beneﬁts (Wiens, 2006). Relationships between the studied genera may have been further obscured by the mistaken orthology of ITS and 5S-NTS (Álvarez and Wendel, 2003). It is possible that we failed to identify homologous copies of distantly related groups, but in lower-level nodes the risk to mistake orthology should be less likely, although still possible. Despite the obvious incongruence in some of the deeper level nodes, the topology of Echinodorus sensu stricto is remarkably similar between our molecular data sets, although morphological data yielded very little resolution at this level. This apparent congruence of molecular data sets is even more evident in the comparison of SPR moves required to transform trees into another (Table 2). Transforming matK tree into nuclear DNA tree required only eight SPR moves, compared with 45–47 moves required for random trees. We believe that this congruence indicates that contradiction between our results and an earlier morphologybased study (Lehtonen, 2006) is a result of homoplasy in the continuously overlapping morphological characters. Our conclusion is based on the fact that transforming the most parsimonious tree of Lehtonen’s (2006) study into our total-evidence tree required a total of 15 SPR moves (tree similarity 0.5833), but conversion of the tree for continuous characters required 21 SPR moves (similarity 0.4167). Although these numbers are clearly lower than the number of SPR moves required for random trees (29–33) of equal size, they are still much higher than required in any comparison of our trees. Because the resolution within Echinodorus was largely due to continuous overlapping characters in Lehtonen’s (2006) study, it seems that those characters are responsible for a large part of the incongruence. We mostly rejected overlapping characters in this study, and therefore our morphology-based tree is more congruent with the molecular data sets. The addition of morphological data into the molecular analysis did not aﬀect the deeper level topology, but it resulted in a topology that is more in accordance with morphology and former classiﬁcation in the otherwise disordered E. grandiflorus group. It seems that in the case of Echinodorus morphology is most useful in studying recently diverged taxa, while molecular evidence is far more important in resolving nodes deeper in the history. This could be due to introgression or conserved ancient polymorphism (Bailey et al., 2003) in the studied sequences of the E. grandiflorus group. Therefore we strongly recommend the use of morphological data in the studies of phylogenetic inference, and this should be done simultaneously (total evidence; Kluge, 1989). Conclusions and future work The aim of our study was to obtain a reliable hypothesis of Echinodorus phylogeny. We believe that our results fulﬁll this goal by providing a solid basis for rejecting previously proposed subgeneric classiﬁcations of Echinodorus. A more detailed discussion of the taxonomy and nomenclature of Echinodorus will be given elsewhere. While our study resolved many long-standing problems in Echinodorus systematics, it also raised new questions about the phylogenetic relationships in S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 Alismataceae. Therefore a simultaneous analysis of the whole family using all the species as terminals is needed. Our results also conﬁrm that taxonomic conclusions based on phylogenetic analyses with a single gene, or only single specimen of each species, should be considered cautiously. Acknowledgments The directors of the mentioned herbaria are acknowledged. S. Lehtonen is grateful to all the assistants who helped in the ﬁeld studies. Maarten Christenhusz, Helmut Hromadnik, Claus-Dieter Junge, Helmut Mühlberg, Curt Quester and Dierk Wanke kindly provided additional material for the study. We thank Pablo Goloboﬀ for his kind advice in the SPR move calculations. This work was funded by Societas pro Fauna et Flora Fennica, and the foundations of Otto A. Malmi, Jenny and Antti Wihuri, Turku University, Emil Aaltonen, and Oskar Öﬂund. Jaakko Hyvönen, Hanna Tuomisto and two anonymous reviewers gave valuable comments to the manuscript. References Álvarez, I., Wendel, J.F., 2003. Ribosomal ITS sequences and plant phylogenetic inference. Mol. Phylogenet. Evol. 29, 417–434. Bailey, C.D., Carr, T.G., Harris, S.A., Hughes, C.E., 2003. Characterization of angiosperm nrDNA polymorphism, paralogy, and pseudogenes. Mol. Phylogenet. Evol. 29, 435–455. Baldwin, B.G., Sanderson, M.J., Porter, J.M., Wojciechowski, M.F., Campbell, C.S., Donoghue, M.J., 1995. The ITS region of nuclear ribosomal DNA: a valuable source of evidence on angiosperm phylogeny. Ann. Mo. Bot. Gard. 82, 247–277. Becerra, J.X., 2003. Evolution of Mexican Bursera (Burseraceae) inferred from ITS, ETS, and 5S nuclear ribosomal DNA sequences. Mol. Phylogenet. Evol. 26, 300–309. Björkqvist, I., 1968. Studies in Alisma L. I. Distribution, variation and germination. Opera Bot. 17, 1–128. Bremer, K., 1988. The limits of amino-acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42, 795–803. Charlton, W.A., 1999. Studies in the Alismataceae. IX. Development of ﬂower in Ranalisma humile. Can. J. Bot. 77, 2790–2791. Chen, J.-M., Chen, D., Gituru, W.R., Wang, Q.-F., Guo, Y.-H., 2004. Evolution of apocarpy in Alismatidae using phylogenetic evidence from chloroplast rbcL gene sequence data. Bot. Bull. Acad. Sin. 45, 33–40. Cook, C.D.K., 1990. Aquatic Plant Book. SPB Academic Publishing, The Hague, Netherlands. Cox, A.V., Bennet, M.D., Dyer, T.A., 1992. Use of the polymerase chain reaction to detect spacer size heterogeneity in plant 5S-rRNA gene clusters and to locate such clusters in wheat (Triticum aestivum L.). Theor. Appl. Genet. 83, 684–690. Doyle, J.J., 1992. Gene trees ans species trees: molecular systematics as one-character taxonomy. Syst. Bot. 17, 144–163. Drábková, L., Kirschner, J., Vlcek, C., 2002. Comparison of seven DNA extraction and ampliﬁcation protocols in historical herbarium specimens of Juncaceae. Plant Mol. Biol. Rep. 20, 161–175. Fassett, N.C., 1955. Echinodorus in the American tropics. Rhodora, 57, 133–156, 174–188, 202–212. 231 Giribet, G., 2001. Exploring the behavior of POY, a program for direct optimization of molecular data. Cladistics 17, S60–S70. Gladstein, D., Wheeler, W.C., 2001. POY documentation and command summary. Available at ftp://ftp.amnh.org/pub/molecular/ poy/ Goloboﬀ, P., Farris, J., Nixon, K., 2003. T.N.T. tree analysis using new technology. Program and documentation, available from the authors, and http://www.zmuc.dk/public/phylogeny/. Grob, G.B.J., Gravendeel, B., Eurlings, M.C.M., 2004. Potential phylogenetic utility of the nuclear FLORICAULA ⁄ LEAFY second intron: comparison with three cloroplast DNA regions in Amorphophallus (Araceae). Mol. Phylogenet. Evol. 30, 13–23. Haynes, R.R., Burkhalter, J.R., 1998. A new species of Echinodorus (Alismataceae) from the United States of America. Castanea 63, 180–182. Haynes, R.R., Hellquist, C.B., 2000. 190 Alismataceae Ventenant. In: Flora of North America Editorial Committee (Ed.), Flora of North America, Vol. 22 Magnoliophyta: Alismatidae, Arecidae, Commelinidae (in Part), and Zingiberidae. Oxford University Press, New York, pp. 7–25. Haynes, R.R., Holm-Nielsen, L.B., 1986. Notes on Echinodorus (Alismataceae). Brittonia 38, 325–332. Haynes, R.R., Holm-Nielsen, L.B., 1994. The Alismataceae. Flora Neotropica. Monograph 64. The New York Botanical Garden, New York. Hilu, K.W., Liang, H., 1997. The matK gene: sequence variation and application in plant systematics. Am. J. Bot. 84, 830–839. Hilu, K.W., Borsch, T., Müller, K., Soltis, D.E., Soltis, P.S., Savolainen, V., Chase, M.W., Powell, M.P., Alice, L.A., Evans, R., Sauquet, H., Neinhuis, C., Slotta, T.A.B., Rohwer, J.G., Campbell, C.S., Chatrou, L.W., 2003. Angiosperm phylogeny based on matK sequence information. Am. J. Bot. 90, 1758–1776. Holmgren, P.K., Holmgren, N.H., 1998. onwards (continuously updated). Index Herbariorum. New York Botanical Garden. http://sciweb.nybg.org/science2/IndexHerbariorum.asp/. Holm-Nielsen, L.B., Haynes, R.R., 1985. Two new Alismatidae from Ecuador and Peru (Alismataceae and Zannichelliaceae). Brittonia 37, 17–21. Jérémie, J., Lobreau-Callen, D., Couderc, H., Jossang, A., 2001. Une nouvelle espèce d’Echinodorus (Alismataceae) de Guadeloupe (Petites Antilles). Observations palynologiques, cytogénétiques et chimiques. Adansonia 23, 191–203. Judd, W.S., Campbell, C.S., Kellogg, E.A., Stevens, P.F., Donoghue, M.J., 2002. Plant Systematics: a Phylogenetic Approach. Sinauer, Sunderland, MA. Kasselmann, C., 2003. Aquarium Plants. Krieger Publishing Co., Malabar, FL. Kluge, A.G., 1989. A concern for evidence and a phylogenetic hypothesis of relationships among Epicrates (Boidae, Serpentes). Syst. Zool. 38, 7–25. Lehtonen, S., 2006. Phylogenetics of Echinodorus (Alismataceae) based on morphological data. Bot. J. Linn. Soc. 150, 291–305. Lehtonen, S., Rodrı́guez Arévalo, L.A., 2005. Notes on aquarium plant production in Peruvian Amazonia. Ethnobot. Res. Appl. 3, 209–214. Les, D.H., Haynes, R.R., 1995. Systematics of subclass Alismatidae. A Synthesis of Approaches. In: Rudall, P.J., Cribb, P.J., Cutler, D.F., Humphries, C.J. (Eds.), Monocotyledons: Systematics and Evolution. Royal Botanical Gardens, Kew, pp. 353–377. Les, D.H., Schneider, E.L., 1995. Aquatic Origin of Monocotyledons. In: Rudall, P.J., Cribb, P.J., Cutler, D.F., Humphries, C.J. (Eds.), Monocotyledons: Systematics and Evolution. Royal Botanical Gardens, Kew, pp. 23–42. Les, D.H., Cleland, M.A., Waycott, M., 1997. Phylogenetic studies in Alismatidae, II: evolution of marine angiosperms (seagrasses) and hydrophily. Syst. Bot. 22, 443–463. Liang, H., Hilu, K.W., 1996. Application of matK gene sequences to grass systematics. Can. J. Bot. 74, 125–134. 232 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 Lindqvist, C., Motley, T.J., Jeﬀrey, J.J., Albert, V.A., 2003. Cladogenesis and reticulation in the Hawaiian endemic mints (Lamiaceae). Cladistics 19, 480–495. Lot, A.H., Novelo, A.R., 1994. Alismataceae. In: Davidse, G., Sousa, M.S., Chater, A.O. (Eds.), Flora Mesoamericana 6 Alismataceae a Cyperaceae. Universidad Nacional Autónoma de México, Missouri Botanical Garden and the Natural History Museum, Mexico and London, pp. 3–8. Micheli, M., 1881. Alismaceae. In: De Candolle, A., De Candolle, C. (Eds.), Monogr. Phan. 3. Sumptibus G. Masson, Paris, pp. 29–83. Nixon, K.C., Carpenter, J.M., 1996. On simultaneous analysis. Cladistics 12, 221–241. Oh, S.-H., Potter, D., 2003. Phylogenetic utility of the second intron of LEAFY. Neillia and Stephanandra (Rosaceae) and implications for the origin of Stephanandra. Mol. Phylogenet. Evol. 29, 203–215. Ooi, K., Endo, Y., Yokoyama, J., Murakami, N., 1995. Useful primer designs to amplify DNA fragments of the plastid gene matK from angiosperm plants. J. Jpn. Bot. 70, 328–331. Persson, C., 2000. Phylogeny of the Neotropical Alibertia group (Rubiaceae), with emphasis on the genus Alibertia, inferred from ITS and 5S ribosomal DNA sequences. Am. J. Bot. 87, 1018–1028. Petersen, G., Seberg, O., Davis, J.I., Stevenson, D.W., 2006. RNA editing and phylogenetic reconstruction in two monocot mitochondrial genes. Taxon 55, 871–886. Pichon, M., 1946. Sur les Alismatacées et les Butomacées. Notul. Syst. (Paris) 12, 170–183. Rataj, K., 1967. Echinodorus intermedius (Martius) Grisebach und verwandte arten des tropischen Amerika. Mitt. Bot. Münch. 6, 613–619. Rataj, K., 1969. Echinodorus grandiflorus (Cham. et Schlecht.) Mich., its geographical distribution and variability. Folia Geobot. Phytotax., Praha 4, 319–326. Rataj, K., 1970. New species of the genus Echinodorus from South Brazil. Folia Geobot. Phytotax., Praha 5, 213–216. Rataj, K., 1975. Revizion [sic!] of the genus Echinodorus Rich. Studie Csav 2, 1–156. Rataj, K., 2004. A new revision of the swordplant genus Echinodorus Richard, 1848 (Alismataceae). Aqua, Journal of Ichtyology and Aquatic Biology, Special Publication no. I, pp. 1–142. Rydin, C., Källersjö, M., 2002. Taxon sampling and seed plant phylogeny. Cladistics 18, 485–513. Sastri, D.C., Hilu, K., Appels, R., Lagudah, E.S., Playford, J., Baum, B.R., 1992. An overview of evolution in plant 5S DNA. Plant Syst. Evol. 183, 169–181. Sauvalle, F.A., 1870. Flora Cubana. Revisio catalogi Grisebachiani vel index plantarum Cubensium. An. Acad. Cien. Méd. Fı́s. Nat. 7, 560–566. Sculthorpe, C.D., 1967. The Biology of Aquatic Vascular Plants. Edward Arnold, London. Small, J.K., 1909. Alismaceae. In: N. Amer. Fl. 17. New York Botanical Garden, New York, pp. 43–62. Soltis, D.E., Soltis, P.S., 1998. Choosing an approach and an appropriate gene for phylogenetic analysis. In: Soltis, D., Soltis, P., Doyle, J. (Eds.), Molecular Systematics of Plants II: DNA Sequencing. Kluwer Academic Publishers, Boston, MA, pp. 1–42. Soltis, D.E., Soltis, P.S., Endress, P.K., Chase, M.W., 2005. Phylogeny and Evolution of Angiosperms. Sinauer Associates, Sunderland, MA. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The ClustalX windows interface: ﬂexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Wheeler, W., 1996. Optimization alignment: the end of multiple sequence alignment in phylogenetics? Cladistics 12, 1–9. Wheeler, W., 2001. Homology and the optimization of DNA sequence data. Cladistics 17, S3–S11. White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Ampliﬁcation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfund, D.H., Sninsky, J.J., White, T.J. (Eds.), PCR Protocols: a Guide to Methods and Applications. Academic Press, San Diego, pp. 315–322. Wiens, J.J., 2006. Missing data and the design of phylogenetic analysis. J. Biomed. Inform. 39, 34–42. Wooten, J.W., 1986. Variations in leaf characteristics of six species of Sagittaria (Alismataceae) caused by various water levels. Aquat. Bot. 23, 321–327. Zwickl, D.J., Hillis, D.M., 2002. Increased taxon sampling greatly reduces phylogenetic error. Syst. Biol. 51, 588–598. Appendix 1: Terminals employed in the analyses with GenBank accession numbers Terminal; voucher specimen for sequences matK ITS LEAFY 5S-NTS Albidella nymphaeifolia (Griseb.) Pichon; Mexico, Lehtonen & Rámirez 399 (TUR) Alisma plantago-aquatica L.; n.a. Baldellia ranunculoides Parl.; n.a. Butomus umbellatus L.; n.a. Caldesia parnassifolia (L.) Parl.; Austria, Hromadnik s.n. (TUR) Echinodorus berteroi (Spreng.) Fassett 1; Guadeloupe, Christenhusz 4081 (TUR) E. berteroi (Spreng.) Fassett 2; Mexico, Lehtonen & Rámirez 412 (TUR) E. bracteatus Micheli ssp. bracteatus (Fasset) Haynes & Holm-Niels.; Ecuador, Lehtonen & Navarrete 491 (TUR) E. bracteatus Micheli ssp. efenestratus (Fasset) Haynes & Holm-Niels.; Ecuador, Lehtonen & Navarrete 494 (TUR) E. cordifolius (L.) Griseb. ssp. cordifolius Haynes & Holm-Niels. 1; Venezuela, Lehtonen 457 (TUR) E. cordifolius (L.) Griseb. ssp. cordifolius Haynes & Holm-Niels. 2; USA, Keener 275 (UNA) E. cordifolius (L.) Griseb. ssp. fluitans (Fassett) Haynes & Holm-Niels. E. cylindricus Rataj E. decumbens Kasselm.; Cultivated, Lehtonen 392 (TUR) E. eglandulosus Holm-Niels. & Haynes EF088125 EF088077 EF088171 EF088026 AF542573 n.a. AY952416 EF088140 EF088121 DQ339085 DQ339092 DQ339094 n.a. EF088073 EF088141 n.a. n.a. EF088189 EF088167 n.a. n.a. n.a. EF088043 EF088022 EF088134 EF088124 EF088087 EF088076 EF088181 EF088170 EF088036 EF088025 EF088137 EF088091 EF088185 EF088040 EF088126 EF088078 EF088172 EF088027 n.a. n.a. EF088190 EF088044 n.a. n.a. EF088117 n.a. n.a. n.a. EF088069 n.a. n.a. n.a. EF088163 n.a. n.a. n.a. EF088018 n.a. 233 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 Appendix 1: Continued Terminal; voucher specimen for sequences matK ITS LEAFY 5S-NTS E. floribundus (Seub.) Seub. 1; Bolivia, Lehtonen 161 (TUR) E. floribundus (Seub.) Seub. 2 ; Bolivia, Lehtonen 188 (TUR) E. floribundus (Seub.) Seub. 3; Venezuela, Lehtonen & Pacheco 485 (TUR) E. floridanus Haynes & Burkhalter; Cultivated, Lehtonen 393 (TUR) E. glandulosus Rataj E. glaucus Rataj; Cultivated, Mühlberg s.n. (TUR) E. grandiflorus (Cham. Schltdl.) Micheli 1; Uruguay, Lehtonen & Delfino 358 (TUR) E. grandiflorus (Cham. Schltdl.) Micheli 2; Argentina, Lehtonen 391 (TUR) E. gracilis Rataj; Cultivated, Mühlberg s.n. (TUR) E. grisebachii Small 1; Peru, Lehtonen & Rodrı´guez 74 (TUR) E. grisebachii Small 2; Bolivia, Lehtonen 151 (TUR) E. heikobleheri Rataj; Cultivated, Quester s.n. (TUR) E. horizontalis Rataj 1; Peru, Lehtonen & Rodrı´guez 99 (TUR) E. horizontalis Rataj 2; Peru, Lehtonen & Rodrı´guez 58 (TUR) E. inpai Rataj; Cultivated, Mühlberg s.n. (TUR) E. lanceolatus Rataj E. longipetalus Micheli; Paraguay, Lehtonen & Burguez 271 (TUR) E. longiscapus Arechav. 1; Argentina, Lehtonen & Dematteis 204 (TUR) E. longiscapus Arechav. 2; Uruguay, Lehtonen 341 (TUR) E. longiscapus Arechav. 3; Uruguay, Lehtonen & Delfino 334 (TUR) E. major (Micheli) Rataj; Cultivated, Lehtonen 394 (TUR) E. macrophyllus (Kunth) Micheli ssp. macrophyllus Haynes & Holm-Niels. E. macrophyllus (Kunth) Micheli ssp. scaber (Rataj) Haynes & Holm-Niels.; Venezuela, Lehtonen & Pacheco 440 (TUR) E. osiris Rataj; Cultivated, Quester s.n. (TUR) E. ovalis Wright ex Sauvalle; Mexico, Lehtonen & Rámirez 417 (TUR) E. palaefolius (Nees & Mart.) J.F.MacBr. E. paniculatus Micheli 1; Bolivia, Lehtonen 168 (TUR) E. paniculatus Micheli 2; Venezuela, Lehtonen & Pacheco 469 (TUR) E. pubescence (Mart.) Seub. ex Warm.; Brazil, Harley et al. 20019 (AAU) E. reticulatus Haynes & Holm-Niels. E. sp1; Paraguay, Lehtonen & Burguez 261 (TUR) E. sp2 1; Peru, Lehtonen 140 (TUR) E. sp2 2; Bolivia, Lehtonen 190 (TUR) E. sp3; Paraguay, Lehtonen & Burguez 275 (TUR) E. sp4; Paraguay, Lehtonen & Burguez 309 (TUR) E. subalatus (Mart.) Griseb. ssp. andrieuxii (Hook. & Arn.) Haynes & Holm-Niels.; Venezuela, Lehtonen & Pacheco 472 (TUR) E. subalatus (Mart.) Griseb. ssp. subalatus Haynes & Holm-Niels. E. tunicatus Small; Peru, Lehtonen 133 (TUR) E. trialatus Fassett 1; Venezuela, Lehtonen & Pacheco 441 (TUR) E. trialatus Fassett 2; Venezuela, Lehtonen & Pacheco 444 (TUR) E. uruguayensis Arechav. 1; Uruguay, Lehtonen & Delfino 364 (TUR) E. uruguayensis Arechav. 2; Argentina, Lehtonen et al. 237 (TUR) E. virgatus (Hook. & Arn.) Micheli Helanthium bolivianum (Rusby) Lehtonen & Myllys 1; Venezuela, Lehtonen & Pacheco 482 (TUR) H. bolivianum (Rusby) Lehtonen & Myllys 2; Argentina, Lehtonen et al. 213 (TUR) H. bolivianum (Rusby) Lehtonen & Myllys 3; Ecuador, Øllgaard et al. 57161 (AAU) H. tenellum (Mart.) Britton 1; Bolivia, Lehtonen 156 (TUR) H. tenellum (Mart.) Britton 2; USA, MacDonald 11345 (UNA) H. zombiense (Jérémie) Lehtonen & Myllys; Guadeloupe, Christenhusz 4040 (TUR) Limnocharis flava Buchenau; n.a. Ranalisma rostrata Stapf; n.a. Sagittaria planitiana Agostini; Venezuela, Lehtonen & Pacheco 428 (TUR) S. montevidensis Cham. Schltdl.; Bolivia, Lehtonen 180 (TUR) S. sprucei Mich.; Peru, Lehtonen & Rodrı´guez 31 (TUR) Wiesneria trianda (Dalzell) Mich.; n.a. EF088106 EF088103 EF088129 EF088118 n.a. EF088132 n.a. EF088057 EF088054 EF088081 EF088070 n.a. EF088084 EF088086 EF088153 EF088150 EF088175 EF088164 n.a. EF088178 EF088180 EF088007 EF088004 EF088030 EF088019 n.a. EF088033 EF088035 EF088113 EF088131 EF088095 EF088102 EF088139 EF088096 EF088099 EF088138 n.a. EF088115 EF088108 EF088112 EF088116 EF088119 n.a. EF088128 EF088065 EF088083 EF088046 EF088053 EF088093 EF088047 EF088050 EF088092 n.a. EF088067 EF088059 EF088063 EF088068 EF088071 n.a. EF088080 EF088160 EF088177 EF088142 EF088149 EF088187 EF088143 EF088146 EF088186 n.a. EF088162 n.a. EF088158 n.a. EF088165 n.a. EF088174 EF088014 EF088032 EF087996 EF088003 EF088041 EF087997 EF088000 n.a. n.a. EF088016 EF088009 EF088012 EF088017 EF088020 n.a. EF088029 n.a. EF088127 n.a. EF088097 EF088130 n.a. n.a. EF088110 EF088100 EF088098 EF088111 EF088133 EF088123 EF088094 EF088079 n.a. EF088048 EF088082 n.a. n.a. EF088061 EF088051 EF088049 EF088062 EF088085 EF088075 EF088188 EF088173 n.a. EF088144 EF088176 EF088193 n.a. EF088156 EF088147 EF088145 EF088157 EF088179 EF088169 EF088042 EF088028 n.a. EF087998 EF088031 EF088045 n.a. EF088010 EF088001 EF087999 EF088011 EF088034 EF088024 n.a. EF088107 EF088122 EF088136 n.a. EF088114 n.a. n.a. n.a. EF088058 EF088074 EF088089 EF088064 EF088066 n.a. EF088090 n.a. EF088154 EF088168 EF088183 EF088159 EF088161 n.a. EF088184 n.a. EF088008 EF088023 EF088038 EF088013 EF088015 n.a. EF088039 EF088109 EF088060 EF088155 n.a. n.a. n.a. EF088192 n.a. EF088105 n.a. EF088120 EF088056 n.a. EF088072 EF088152 EF088191 EF088166 EF088006 n.a. EF088021 AB088778 n.a. EF088135 EF088101 EF088104 n.a. n.a. AY395986 EF088088 EF088052 EF088055 AY335953 n.a. n.a. EF088182 EF088148 EF088151 n.a. n.a. n.a. EF088037 EF088002 EF088005 n.a. 234 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 Appendix 2: Morphological characters 0 1 2 3 Rhizome: (0) erect; (1) horizontal. Rhizome: (0) short; (1) long. Rhizome: (0) thin; (1) thick. Submersed leaves: (0) not diﬀerentiated; (1) morphologically diﬀerentiated. 4 Leaf blades: (0) not undulating; (1) undulating. 5 Leaf blades: (0) 1–5 cm long; (1) 5–8 cm long; (2) 8–15 cm long; (3) over 15 cm long. 6 Leaf shape: (0) widest at the central 1 ⁄ 3 of the blade; (1) widest at the basal 1 ⁄ 3 of the blade. 7 Leaf blade: (0) more than 3 times as long as wide; (1) less than 2.5 times as long as wide. 8 Base of the leaf blade: (0) attenuate; (1) truncate. 9 Basal lobe: (0) absent; (1) less than 6% of the length of the blade; (2) 6–25% of the length of the blade; (3) more than 25% of the length of the blade. 10 Basal lobe: (0) not sagittate; (1) sagittate. 11 Apex of the blades: (0) acute; (1) obtuse; (2) retuse. 12 Leaf veins: (0) weak; (1) strong. 13 Number of parallel leaf veins: (0) 1–3; (1) 3–7; (2) 7–15; (3) 15–25. 14 Angle of secondary veins: (0) less than 38; (1) 38–65; (2) over 65. 15 Leaves: (0) without waxy cover; (1) covered with bluish wax. 16 Leaves: (0) not pseudopenninerved; (1) pseudopenninerved. 17 Pellucid markings: (0) absent; (1) present. 18 Pellucid dots: (0) absent; (1) present. 19 Pellucid lines: (0) absent; (1) present. 20 Pellucid network: (0) absent; (1) present. 21 Cross-section of petiole: (0) round; (1) triangular. 22 Petiole: (0) not angled; (1) angled. 23 Petiole: (0) not channeled; (1) channeled. 24 Petiole: (0) no bulb under the blade; (1) bulb under the blade. 25 Hairs: (0) absent; (1) few; (2) abundant. 26 Hair type: (0) simple; (1) stellate. 27 Petiole: (0) not alate; (1) alate. 28 Cross-section of peduncle: (0) round; (1) triangular. 29 Inﬂorescence: (0) not branching; (1) 1–2 branches; (2) more branches. 30 Inﬂorescence: (0) without secondary branches; (1) with secondary branches. 31 Peduncle: (0) not ridged; (1) ridged. 32 Peduncle: (0) not angled; (1) angled. 33 Pseudostolons: (0) absent; (1) present. 34 Inﬂorescence vegetatively proliferating: (0) no; (1) yes. 35 Inﬂorescence: (0) creeping; (1) erect. 36 Length of inﬂorescence: (0) less than 30 cm; (1) 30– 100 cm; (2) 100–150 cm; (3) over 200 cm. 37 Whorls in inﬂorescence: (0) less than 5; (1) 5–13; (2) more. 38 Internodes between whorls: (0) less than 10 cm long; (1) over 10 cm long. 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 Flowers per whorl: (0) 3; (1) more. Inﬂorescence: (0) glabrous; (1) scabrous. Cross-section of rachis: (0) round; (1) triangular. Rachis: (0) not alate; (1) alate. Pedicels: (0) spreading in fruit; (1) recurved in fruit. Pedicels: (0) not growing after ﬂowering; (1) growing after ﬂowering. Pedicels: (0) less than 1 cm long; (1) 1–4 cm long; (2) over 4 cm long. Anther: (0) 0.5–1 mm long; 1.5–2 mm long. Petals: (0) with spot at the base; (1) not spotted. Petals: (0) not claved; (1) claved. Petals: (0) not overlapping; (1) widely overlapping. Apex of the petals: (0) round; (1) retuse. Apex of the petals: (0) divided; (1) entire. Flowers: (0) without strong odor; (1) with strong odor. Flower diameter: (0) less than 1.5 cm; (1) over 2 cm. Sepals: (0) not surrounding fruiting aggregate; (1) surrounding mature fruiting aggregate. Sepals: (0) spreading; (1) erect. Sepal veins: (0) without papillae; (1) with papillae. Sepal veins: (0) 8–12; (1) 15–21; (2) 24–30. Sepal veins: (0) weak; (1) strong. Bract veins: (0) weak; (1) strong. Bract veins: (0) 0–9; (1) 11–20. Bracts: (0) free; (1) deeply connate. Apex of bracts: (0) rounded; (1) acute; (2) acuminate. Bracts: (0) less than 1 cm long; (1) much longer. Bracts: (0) less than twice as long as wide; (1) two to ﬁve times as long as wide; (2) more than ﬁve times as long as wide. Bracts: (0) delicate; (1) strong. Bracts: (0) persistent; (1) deciduous. Anthers: (0) basiﬁxed; (1) versatile. Stamens: (0) 6; (1) 9; (2) 12; (3) 15–20; (4) 20–35; (5) 3. Carpels: (0) about 15; (1) about 50; (2) about 150; (3) about 500. Carpels: (0) open at anthesis; (1) closed. Fruiting head: (0) dense; (1) loose. Flowers: (0) perfect; (1) imperfect. Fruits: (0) 1–2 mm long; (1) 2–4 mm long; (2) about 10 mm long. Fruit: (0) follicle; (1) achene. Fruit beak: (0) horizontal; (1) erect. Fruit beak length: (0) less than 20% of the fruit body; (1) 20–50% of the fruit body; (2) over 50% of the fruit body. Fruit glands: (0) small; (1) large. Fruit glands: (0) absent; (1) 1 or 2; (2) more. Fruit ribs: (0) weak; (1) strong. Fruit ribs: (0) absent; (1) 1–3; (2) more. Fruits: (0) round; (1) oblanceolate. Fruits: (0) ﬂattened; (1) not ﬂattened. Air chambers in fruit: (0) absent; (1) present. Fruits: (0) not winged; (1) winged. Fruits: (0) not keeled; (1) keeled; (2) 2-keeled. Appendix 3: Morphological character matrix Polymorphic entries: a ¼ [01], b ¼ [12], c ¼ [012]. Inapplicable data ¼ ’’-’’. Missing data ¼ ’’?’’. 1111030000-003?000---10000-000-0000120-10--002100001?101000010111100100102011-0-001000 ?0-1020101-102200100110000-010-0000110-10--00210100101110200100100004000020---00100010 00010101a100011000---00000-002100001110100000100100000010000101111000000011---0-000000 ?001010000-0001000---?0000-000-0011a1011000002001001?000010011100000001101110-01111001 ???103?000-000?000---??000-0?0-0000a11010?0000???0???00????????0????50??1?1??-0010110? ????00?000-1?0?000---??000-0?0-0011a?0000?00?1???????00?????????????11??0?111?1-00001? ?0000111130102b000---00000-0020000111101000001001000?000010000101100001101111-01111000 0000020100-102200????00000-000-0000110000100011?100101010?00?0?00000031011101-0001001? 11110311131103200100100000-000-0000110000001001010010101020011000000431011101-00010011 00000201131103200100100000-000-0000111000001001110010001010010000010131011101-00010011 00010101130102200101000000-00210000111010100010??0???00000000011110000?100110111101001 0001000000-0000000---00000-000-0011a0001000001011011001100000010100010?100110-01101000 0001000000-0001000---00000-000-0011a0001000001011011001100000010000010?100110-01101000 0001000000-000100101000000-000-0011a0001000001011011?01100000010000010?100112-00101000 ?0-1000000-0000000---00000-00100011a0001000001011011001100000010000010?100110-01101000 ?0-1000000-0000000---00000-000-0011a0001000001011011001100000010000010?100110-01101000 ?0-1000000-0000000---00000-000-0011a1011000002011011001100000010100010?100110-01101000 0001011101-111100101001000-00100100110010100010110010000000000111101221001112111211002 00010111110112100101001000-00200100111010100010110010000000000111101221001112111211002 11101311120112200111000001100201001122011111001101010101011110211101311001110111211001 111013111201122000---00001100201001122011111001101010101011110211101311001110111211001 11100211120112200111000001100201001021111000021101010100101110211101421001110121111001 1110021112011220010100000110010100102111010002110101010010111021110142?001110121111001 111002111200122000---00000-0010?001021110100021101010100?01110211101421001110121111001 1110030000-0111100---00000-00100000121010000001101010101021110210101421001111111211001 1110030000-011100101011100-001010010211101100000000100000111112121012?1001111111211001 11011200a0-011201101010000-01100001a1101010100010001000000?101212101111000110???111001 11100311120213200110000001100200001131011000011101010101011110211101421001110120111001 111003111202132000---0000110020000?131011000011101010101011110211101421001110120111001 11100311120213200110000001100200001131011000011101010101011110211101421001110120111001 11100301010112100111000011100200000121011100121101010101011110211101421001110120111001 1?100211a20112200100100?01?0020?00?121010110010?0001?00100??102111013?1001111111111001 111003111200122100---00000-00100000121010000001101010101021110210101421001111111211001 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 Butomus umbellatus Limnocharis flava Alisma plantago-aquatica Baldellia ranunculoides Wiesneria trianda Ranalisma rostrata Caldesia parnassifolia Sagittaria planitiana S. montevidensis S. sprucei Albidella nymphaeifolia Helanthium cf. bolivianum 1 H. bolivianum 2 H. bolivianum 3 H. tenellum 1 H. tenellum 2 H. zombiense Echinodorus berteroi 1 E. berteroi 2 E. bracteatus ssp. bracteatus E. bracteatus ssp. efenestratus E. cordifolius ssp. cordifolius 1 E. cordifolius ssp. cordifolius 2 E. cordifolius ssp. fluitans E. cylindricus E. decumbens E. eglandulosus E. floribundus 1 E. floribundus 2 E. floribundus 3 E. floridanus E. glandulosus E. glaucus E. grandiflorus 1 E. grandiflorus 2 E. gracilis E. grisebachii 1 E. grisebachii 2 E. heikobleheri E. horizontalis 1 E. horizontalis 2 E. inpai E. lanceolatus E. longipetalus E. longiscapus 1 E. longiscapus 2 E. longiscapus 3 1110030111011210011100001110020000?121011100111101010101011110211101421001110120111001 1110030101011210011100001110020000?121011100121101010101011110211101421001110120111001 1101110000-011201101010000-010-000111101010100010001000000110?200101111000110021111001 11011200a0-011201101010000-01100001011010101000100010000001101212101111000110021111001 1101120000-011201101010000-01200001111010101000100010000001101212101111000110021111001 ?1?1130000-0111010---10000-010-000101001010100010001000?0???002??1011?1000111021111001 01000311120012200100100010-000-0001010110001010100010011010110211111431001100020111001 01000311120012200100100010-000-0001010110001010100010011010110211111431001100020111001 ?1?0030000-111100101010100-1010?0001110101000001000100000011??2011012?1001112111111001 ???0030000-0110000---00?00-0020000?12101010000????????0100111021110??21001111021211001 1110030000-011101100110000-100-010013101010101110101?111021110211101431001100-00210011 111002011201122001110000011000-1001111011100001101010101011110211101421001110120111001 111002011201122001110000011000-000?111011100001101010101011110211101421001110120111001 11100201120112200111000000-0010100?111011100001101010101011110211101421001110120111001 235 236 Appendix 3: Continued major macrophyllus ssp. macrophyllus macrophyllus ssp. scaber osiris ovalis paniculatus 1 paniculatus 2 palaefolius pubescence reticulatus sp1 sp2 1 sp2 2 sp3 sp4 subalatus ssp. andrieuxii subalatus ssp. subalatus tunicatus trialatus 1 trialatus 2 uruguayensis 1 uruguayensis 2 virgatus ?1?1130000-1111010---10010-000-0001111010100001?000100010011102111012?1000110021211001 111003111300122000---00001100201001121011000011?0101?100011110211101321001111121211001 111003111201122000---00002100201000132011000010100010001011110211101321001111111211001 0100120000-111101101000000-000-000101101010001110??111??0101102111013?10011???2??1100? 1110020000-1111001110000011000-1001021111100021101010100101110211101321001110121211001 1110031000-0111000---10000-01200000121010100011101010100001110211101421001110-01211001 111003101000111000---10000-01200001021010100011101010100001110211101421001110-01211001 11100301a2011220010101110c00010?00012201a11a001000010000a01111211101221001111111211001 11100300a10112100101000002000100000122011100000000010001111111211101221001111111211001 1110030000-011101100110000-100-010013101010101110101?111021110211101431001100-00210011 1100010000-011100101010000-000-00010100101000211000101000111102011013?1001110021?11001 111003111201122000---00002100101001122011000000101010101011110200101321001111-01211001 111003111201122000---000021000-100?12201100000010101?101011110200101321001111-01211001 1110030000-011?00101000001100200001a21111100?1110101010?00111021210142100111?????1100? 11100201120112200111000001100200001021011100011101010101011110211101421001110120111001 1110030000-1111000---11101000101001121011110000000010000001111212101221001112111211001 1110030000-111100101011100-0010?00112101011000000001?000a01111211101221001111111211001 01000311120012200100100010-000-0001110010101010100010011010110211111431001100020211001 1101030000-0112010---10000-01000000111010111000100010001011110211101221001110-01211001 1101030000-0112010---10000-01000000111010111000100010001011110211101221001110-01211001 1101020000-1111011010a0000-000-0001110010100011101111101001110211101321001110111111001 1101020000-1111010---10000-000-000101001010001110??11101001110211101321001110111111001 1110030112011210010101010a00010?00?12101a11a001?0?????0??0111?21110?2?1001111121211001 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. E. S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 Appendix 4: List of examined specimens Albidella nymphaeifolia, Mexico: 2 km N of China; Lehtonen & Rámirez 399 (TUR, MEXU), Lehtonen & Rámirez 400 (TUR, MEXU), Lehtonen & Rámirez 401 (TUR, MEXU), Lehtonen & Rámirez 402 (TUR, MEXU), Lehtonen & Rámirez 403 (TUR, MEXU), Lehtonen & Rámirez 404 (TUR, MEXU), Gutierrez 5608 (MEXU). Alisma plantago-aquatica, Finland; Lehtonen 395 (TUR). Baldellia ranunculoides, Netherlands; Bodlaender s.n. (TUR), Berge s.n. (H). Butomus umbellatus, Estonia; Kari s.n. (TUR). Caldesia parnassifolia, Austria; Hromadnik s.n. (TUR). Echinodorus berteroi 1, Guadeloupe; Christenhusz 4081 (TUR), Stehle 1555 (UC). E. berteroi 2, Mexico: close to Ebona; Lehtonen & Rámirez 412 (TUR), Lehtonen & Ramı́rez-Garcı́a 413 (TUR, MEXU), Lehtonen & Ramı́rez-Garcı́a 414 (TUR, MEXU), Lehtonen & Ramı́rez-Garcı́a 415 (TUR, MEXU), Oliva & Rámon 1086 (MEXU). E. bracteatus ssp. bracteatus, Ecuador: close to Daule; Lehtonen & Navarrete 491 (TUR, QCA), Lehtonen & Navarrete 492 (TUR, QCA), Lehtonen & Navarrete 493 (TUR, QCA). E. bracteatus ssp. efenestratus, Ecuador: between Balzar and Palenque; Lehtonen & Navarrete 494 (TUR, QCA). E. cordifolius ssp. cordifolius 1, Venezuela: between Maicillal and Piritu; Lehtonen 456 (TUR, VEN), Lehtonen 457 (TUR, VEN), Lehtonen 458 (TUR, VEN), Lehtonen 459 (TUR, VEN), Lehtonen 460 (TUR, VEN), Lehtonen 461 (TUR, VEN), Lehtonen 462 (TUR, VEN), Lehtonen 463 (TUR, VEN), Lehtonen 464 (TUR, VEN), Lehtonen 465 (TUR, VEN), Steyermark & Braun 94514 (VEN). E. cordifolius ssp. cordifolius 2, USA: Alabama; Keener 275 (UNA). E. cordifolius ssp. fluitans, Colombia: near Riohacha; Haught 4450 (UC). E. cylindricus, Brazil: Pantanal; Pott et al 406 (UNA), Pott et al. 402 (UNA), Pott et al. 3925 (UNA). E. decumbens, Brazil: Kasselmann 205 (M), Cultivated; Lehtonen 392 (TUR). E. eglandulosus, Ecuador: Holm-Nielsen et al. 19996 (AAU, UNA), Holm-Nielsen et al. 19844 (AAU, QCA). E. floribundus 1, Bolivia: Laguna Suarez; Lehtonen 160 (TUR, LPB), Lehtonen 161 (TUR, LPB), Lehtonen 162 (TUR, LPB), Lehtonen 163 (TUR, LPB), Lehtonen 164 (TUR, LPB), Lehtonen 165 (TUR, LPB), Sanjines et al. 40 (LPB), Sanjines & Orellano 347 (LPB). E. floribundus 2, Bolivia: Laguna Normandia; Lehtonen 187 (TUR, LPB), Lehtonen 188 (TUR, LPB). 237 E. floribundus 3, Venezuela: Moquete river; Lehtonen & Pacheco 485 (TUR, VEN), Lehtonen & Pacheco 486 (TUR, VEN). E. floridanus, Cultivated; Lehtonen 393 (TUR), USA; Junge s.n. (M), Reese 1 (UNA), Reese 2 (UNA), Reese 24 (UNA), Haynes & Burkhalter 9617 (UNA). E. glandulosus, Brazil: Pickel 64a (SP). E. glaucus, Cultivated: Mühlberg s.n. (TUR), Brazil; da Silva 411 (SP). E. grandiflorus 1, Uruguay: Maldonado; Lehtonen & Delﬁno 357 (TUR, MVJB), Lehtonen & Delﬁno 358 (TUR, MVJB). E. grandiflorus 2, Argentina: Gualeguaychú; Lehtonen 386 (TUR), Lehtonen 387 (TUR), Lehtonen 388 (TUR), Lehtonen 389 (TUR), Lehtonen 390 (TUR) Lehtonen 391 (TUR), Burkhart & Troncoso 26118 (SI). E. gracilis, Cultivated; Mühlberg s.n. (TUR). E. grisebachii 1, Peru: close to Iquitos; Lehtonen & Rodrı́guez 72 (AMAZ), Lehtonen & Rodrı́guez 73 (AMAZ), Lehtonen & Rodrı́guez 74 (TUR), Lehtonen & Rodrı́guez 75 (AMAZ), Lehtonen & Rodrı́guez 76 (AMAZ), Lehtonen & Rodrı́guez 77 (TUR), Lehtonen & Rodrı́guez 78 (TUR), Lehtonen & Rodrı́guez 79 (AMAZ), Lehtonen & Rodrı́guez 80 (TUR), Lehtonen & Rodrı́guez 81 (AMAZ), Lehtonen & Rodrı́guez 82 (AMAZ), Lehtonen & Rodrı́guez 83 (TUR), Lehtonen & Rodrı́guez 84 (AMAZ). E. grisebachii 2, Bolivia: Chimore; Lehtonen 148 (TUR, LPB), Lehtonen 149 (TUR, LPB), Lehtonen 150 (TUR, LPB), Lehtonen 151 (TUR, LPB), Lehtonen 152 (TUR, LPB), Lehtonen 153 (TUR, LPB). E. heikobleheri, Cultivated; Quester s.n. (TUR). E. horizontalis 1, Peru: Nuevo Horizonte; Lehtonen & Rodrı́guez 98 (TUR), Lehtonen & Rodrı́guez 99 (TUR), Lehtonen & Rodrı́guez 100 (AMAZ), Lehtonen & Rodrı́guez 101 (TUR) Lehtonen & Rodrı́guez 102 (TUR), Lehtonen & Rodrı́guez 103 (TUR). E. horizontalis 2, Peru: Tahuyao river; Lehtonen & Rodrı́guez 52 (TUR), Lehtonen & Rodrı́guez 53 (AMAZ), Lehtonen & Rodrı́guez 54 (TUR), Lehtonen & Rodrı́guez 55 (AMAZ), Lehtonen & Rodrı́guez 56 (TUR), Lehtonen & Rodrı́guez 57 (AMAZ), Lehtonen & Rodrı́guez 58 (TUR), Lehtonen & Rodrı́guez 59 (AMAZ). E. inpai, Cultivated; Mühlberg s.n. (TUR). E. lanceolatus, Brazil: São Paulo; Burchell 4158 (BR, K). E. longipetalus, Paraguay: Caaguazú; Lehtonen & Burguez 270 (TUR, FCQ), Lehtonen & Burguez 271 (TUR, FCQ), Mereles & Soloaga 7452 (FCQ). E. longiscapus 1, Argentina: close to Ituzaingó; Lehtonen & Dematteis 204 (TUR), Lehtonen & Dematteis 205 (TUR). E. longiscapus 2, Uruguay: Chuy; Lehtonen 341 (TUR, MVJB), Lehtonen 341 (TUR, MVJB). 238 S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 E. longiscapus 3, Uruguay: Ruta14; Lehtonen & Delﬁno 334 (TUR, MVJB), Lehtonen & Delﬁno 335 (TUR, MVJB), Lehtonen & Delﬁno 337 (TUR, MVJB). E. major, Cultivated; Lehtonen 394 (TUR), Brazil; Bleher 114918 ⁄ 62 (K). E. macrophyllus ssp. macrophyllus, Brazil; Miers s.n. (BM), Sellow 194 (BM), Bowie & Cunningham s.n. (BM), Gardner 700 (BM, K), Harley et al. 18210 (AAU, K), Luetzelberg 222 (M). E. macrophyllus ssp. scaber, Venezuela: Guárico; Lehtonen & Pacheco 433 (TUR, VEN), Lehtonen & Pacheco 434 (TUR, VEN), Lehtonen & Pacheco 436 (TUR, VEN), Lehtonen & Pacheco 440 (TUR, VEN). E. osiris, Cultivated; Quester s.n. (TUR). E. ovalis, Mexico: close to Pánuco; Lehtonen & Rámirez 417 (TUR, MEXU), Lehtonen & Rámirez 418 (TUR, MEXU), Lehtonen & Rámirez 419 (TUR, MEXU), Lehtonen & Rámirez 422 (TUR, MEXU), Lehtonen & Rámirez 423 (TUR, MEXU). E. palaefolius, Brazil: 6 km NE of Mossamedes; Anderson 10174 (UNA). E. paniculatus 1, Bolivia: Laguna Suarez; Lehtonen 166 (TUR, LPB), Lehtonen 167 (TUR, LPB), Lehtonen 168 (TUR, LPB), Lehtonen 169 (TUR, LPB), Lehtonen 170 (TUR, LPB), Lehtonen 171 (TUR, LPB), Lehtonen 172 (TUR, LPB), Lehtonen 173 (TUR, LPB), Lehtonen 174 (TUR, LPB), Lehtonen 175 (TUR, LPB). E. paniculatus 2, Venezuela: close to Barcelona; Lehtonen & Pacheco 469 (TUR, VEN), Lehtonen & Pacheco 470 (TUR, VEN), Lehtonen & Pacheco 471 (TUR, VEN). E. pubescence, Brazil; Harley et al. 20019 (AAU, K). E. reticulatus, Suriname: Sipaliwini; Oldenburger et al. 292 (NY, U). E. sp1, Paraguay: Villa Florida; Mereles et al. 8512 (FCQ), Lehtonen & Burguez 260 (TUR, FCQ), Lehtonen & Burguez 261 (TUR, FCQ), Lehtonen & Burguez 262 (TUR, FCQ), Lehtonen & Burguez 263 (TUR, FCQ), Lehtonen & Burguez 264 (TUR, FCQ), Lehtonen & Burguez 265 (TUR, FCQ), Lehtonen & Burguez 266 (TUR, FCQ), Lehtonen & Burguez 267 (TUR, FCQ), Lehtonen & Burguez 268 (TUR, FCQ). E. sp2 1, Peru: Sungachicocha; Lehtonen 135 (TUR, AMAZ), Lehtonen 136 (TUR, AMAZ), Lehtonen 137 (TUR, AMAZ), Lehtonen 138 (TUR, AMAZ), Lehtonen 139 (TUR, AMAZ), Lehtonen 140 (TUR, AMAZ), Lehtonen 141 (TUR, AMAZ), Lehtonen 142 (TUR, AMAZ). E. sp2 2, Bolivia: close to Laguna Normandia; Lehtonen 190 (TUR, LPB), Lehtonen 191 (TUR, LPB). E. sp3, Paraguay: close to Yhú; Lehtonen & Burguez 274 (TUR, FCQ), Lehtonen & Burguez 275 (TUR, FCQ). E. sp4, Paraguay: Pte. Hayes; Lehtonen & Burguez 305 (TUR, FCQ), Lehtonen & Burguez 306 (TUR, FCQ), Lehtonen & Burguez 308 (TUR, FCQ), Lehtonen & Burguez 309 (TUR, FCQ). E. subalatus ssp. andrieuxii, Venezuela: close to Barcelona; Lehtonen & Pacheco 472 (TUR, VEN), Lehtonen & Pacheco 477 (TUR, VEN). E. subalatus ssp. subalatus, Bolivia: Perseverancia; Vargas 639 (UNA, LPB). E. tunicatus, Peru: Sungachi; Lehtonen 104 (TUR, AMAZ), Lehtonen 105 (TUR, AMAZ), Lehtonen 106 (TUR, AMAZ), Lehtonen 107 (TUR, AMAZ), Lehtonen 108 (TUR, AMAZ), Lehtonen 109 (TUR, AMAZ), Lehtonen 110 (TUR, AMAZ), Lehtonen 111 (TUR, AMAZ), Lehtonen 112 (TUR, AMAZ), Lehtonen 113 (TUR, AMAZ), Lehtonen 114 (TUR, AMAZ), Lehtonen 115 (TUR, AMAZ), Lehtonen 118 (TUR, AMAZ), Lehtonen 119 (TUR, AMAZ), Lehtonen 120 (TUR, AMAZ), Lehtonen 121 (TUR, AMAZ), Lehtonen 122 (TUR, AMAZ), Lehtonen 123 (TUR, AMAZ), Lehtonen 124 (TUR, AMAZ), Lehtonen 125 (TUR, AMAZ), Lehtonen 126 (TUR, AMAZ), Lehtonen 127 (TUR, AMAZ), Lehtonen 128 (TUR, AMAZ), Lehtonen 129 (TUR, AMAZ), Lehtonen 130 (TUR, AMAZ), Lehtonen 131 (TUR, AMAZ), Lehtonen 132 (TUR, AMAZ), Lehtonen 133 (TUR, AMAZ), Lehtonen 134 (TUR, AMAZ), Lehtonen 147 (TUR, AMAZ). E. trialatus 1: Venezuela: Espino; Lehtonen & Pacheco 441 (TUR, VEN), Lehtonen & Pacheco 442 (TUR, VEN), Lehtonen & Pacheco 443 (TUR, VEN). E. trialatus 2: Venezuela: Espino; Lehtonen & Pacheco 444 (TUR, VEN), Lehtonen & Pacheco 445 (TUR, VEN), Lehtonen & Pacheco 446 (TUR, VEN), Lehtonen & Pacheco 447 (TUR, VEN). E. uruguayensis 1, Uruguay: Arroyo del Soldado; Lehtonen & Delﬁno 360 (TUR, MVJB), Lehtonen & Delﬁno 361 (TUR, MVJB), Lehtonen & Delﬁno 362 (TUR, MVJB), Lehtonen & Delﬁno 363 (TUR, MVJB), Lehtonen & Delﬁno 364 (TUR, MVJB), Lehtonen & Delﬁno 365 (TUR, MVJB), Lehtonen & Delﬁno 366 (TUR, MVJB). E. uruguayensis 2, Argentina: Arroyo Apuaray mi; Lehtonen et al. 231 (TUR), Lehtonen et al. 232 (TUR), Lehtonen et al. 233 (TUR), Lehtonen et al. 234 (TUR), Lehtonen et al. 235 (TUR), Lehtonen et al. 236 (TUR), Lehtonen et al. 237 (TUR). E. virgatus, Mexico: Tepic; Beechy s.n. (K). Helanthium cf. bolivianum 1, Venezuela: Moquete river; Lehtonen & Pacheco 481 (TUR, VEN), Lehtonen & Pacheco 482 (TUR, VEN), Lehtonen & Pacheco 483 (TUR, VEN), Lehtonen & Pacheco 484 (TUR, VEN). H. bolivianum 2, Argentina: Montecarlo; Lehtonen et al. 213 (TUR), Lehtonen et al. 214 (TUR), Lehtonen et al. 215 (TUR), Lehtonen et al. 216 (TUR), Lehtonen et al. 217 (TUR), Lehtonen et al. 218 (TUR), Lehtonen et al. 219 (TUR), Lehtonen et al. 220 (TUR), Lehtonen et al. 221 (TUR), Lehtonen et al. 222 (TUR), Lehtonen et al. 223 (TUR). H. bolivianum 3, Ecuador: Laguna Añangu; Øllgaard et al. 57161 (AAU QCA, QCNE). S. Lehtonen and L. Myllys / Cladistics 24 (2008) 218–239 H. tenellum 1, Bolivia: San Ignacio; Lehtonen 154 (TUR, LPB), Lehtonen 155 (TUR, LPB), Lehtonen 156 (TUR, LPB), Lehtonen 157 (TUR, LPB), Lehtonen 158 (TUR, LPB), Lehtonen 159 (TUR, LPB). H. tenellum 2, USA: Alabama; MacDonald 11345 (UNA), MacDonald 11187 (UNA). H. zombiense, Guadeloupe: Jérémie 2062 (UNA), Christenhusz & Katzer 4040 (TUR). Limnocharis flava, Peru: close to Iquitos; Lehtonen & Arévalo 33 (TUR), Lehtonen & Arévalo 34 (TUR). Sagittaria planitiana, Venezuela: close to Las Vegas; Lehtonen & Pacheco 428 (TUR, VEN). S. montevidensis, Bolivia: San Ignacio de Moxos; Lehtonen 180 (TUR, LPB). S. sprucei, Peru: close to Iquitos; Lehtonen & Arévalo 31 (TUR), Lehtonen & Arévalo 32 (TUR). 239 Appendix 5: Command line used in POY analyses poy –parallel –solospawn 7 –molecularmatrix 111 – maxtrees 5 –holdmaxtrees 30 –random n* –multibuild 5 –ratchettbr 3 –ratchettrees 2 –treefuse –fuselimit 25 – fusingrounds 1 –slop 2 –checkslop 5 –seed )1 –ﬁtchtrees –noleading –norandomizeoutgroup –indices –diagnose – impliedalignment *number of random addition sequence searches was 40 for total-evidence analysis, and 50 for combined DNA, nuclear DNA, and matK analyses, and 20 for Bremer support analyses.

RELATED PAPERS

RELATED TOPICS

Log In

Cladistic analysis of Echinodorus (Alismataceae): simultaneous analysis of molecular and morphological data

Cladistic analysis of Echinodorus (Alismataceae): simultaneous analysis of molecular and morphological data

Related Papers

RELATED PAPERS

RELATED TOPICS