P u b l i s h i n g
australian
s y s t e m at i c
b ota n y
Volume 15, 2002
© CSIRO 2002
An inter national jour nal devoted
t o t h e t a x o n o my, b i o g e o g r a p hy
and evolution of all plant groups
All enquiries and manuscripts should be directed to:
Australian Systematic Botany
CSIRO Publishing
PO Box 1139 (150 Oxford St)
Collingwood, Vic. 3066, Australia
Telephone: +61 3 9662 7613
Fax: +61 3 9662 7611
Email: publishing.asb@csiro.au
Published by CSIRO Publishing
for CSIRO and the Australian Academy of Science
w w w. p u b l i s h . c s i ro . a u / j o u r n a l s / a s b
7 May 2002
Australian Systematic Botany 15, 181–191
The phylogenetic and taxonomic position of Lilaeopsis (Apiaceae),
with notes on the applicability of ITS sequence data
for phylogenetic reconstruction
Gitte PetersenAC, Ole SebergA and Sidsel LarsenB
A
Botanical Institute, University of Copenhagen, Gothersgade 140, DK-1123 Copenhagen K, Denmark.
B
Present address: Zoological Museum, University of Copenhagen, Universitetsparken 15,
DK-2100 Copenhagen Ø, Denmark.
C
Corresponding author; email: gittep@bot.ku.dk
SBetPhG.0yPeal0ogte1l. 0ern7sictnnadtaoxnmoicopsit nofo
G.Peterse,O.nSebgreanS.dLarsne
Abstract. The relationships of the genus Lilaeopsis Greene have been difficult to determine primarily due to its
simple morphology with entire, linear to spathulate leaves, simple umbels and lack of carpophore. Consequently,
the genus has been referred to both Hydrocotyloideae and Apioideae. DNA sequence data from different genes
(rbcL and matK) and non-coding regions (rpoC1 intron and ITS) were explored in order to determine the
phylogenetic relationships of Lilaeopsis. Separate and combined analyses of rpoC1 intron, rbcL and matK data give
almost congruent results with respect to a clade including Lilaeopsis. The three species of Lilaeopsis included in
the analyses form a monophyletic group within the Oenanthe clade and hence belong to the Apioideae. Presently,
the Mexican genus Neogoezia Hemsl. is considered its most likely sister group. Optimisation alignment of the ITS
sequence data results in widely different phylogenetic hypotheses, but on the basis of congruence tests, two very
similar trees can be selected. These trees are, however, incongruent with the trees obtained from analyses of the
chloroplast sequences. As alignment of the ITS sequences is problematic even within the Oenanthe clade, the
reliability of phylogenies on the basis of ITS data of higher taxonomic levels in the Apiaceae is questioned.
However, for phylogenetic analysis within Lilaeopsis ITS sequences may prove useful and unproblematic.
Introduction
The taxonomic position of the genus Lilaeopsis Greene has
been controversial for more than a century, the main question
being whether its closest relatives are found in the
Hydrocotyloideae or the Apioideae. Lilaeopsis has recently
been monographed (Affolter 1985), but this work contributes
little to the solution of the problems of its relationships to
other genera or to elucidating interspecific relationships.
The first species today recognised as belonging to
Lilaeopsis was described by Linnaeus (1753) as Hydrocotyle
chinensis L. It was transferred to Crantzia by Nuttall (1818)
and in the subsequent years a number of new species were
described. However, Crantzia is a younger homonym and
Greene (1891) published the replacement name Lilaeopsis to
acknowledge its vegetative resemblance to Lilaea Humb. &
Bonpl. (Juncaginaceae). In the latest monograph, Affolter
(1985) recognised 13 species and recently one more has been
described (Petersen and Affolter 1999).
The species of Lilaeopsis are either truly aquatics or
occupy moist, fresh or brackish water habitats. Nine species
occur in the Americas, two in Australia, two in New Zealand
and one on Mauritius in the Indian Ocean. An unidentified
© CSIRO 2002
species has been reported from Kerguelen and a dubious
record exists from Madagascar (Raynal 1977; Affolter
1985). The predominantly Southern Hemispheric
distribution pattern calls for a cladistic, biogeographic
analysis (Linder and Crisp 1995; Humphries and Parenti
1999), but prior to cladistic analysis of the genus its
monophyly needs to be demonstrated and its sister group
relationships should be clarified.
The difficulties encountered in placing the genus on the
basis of morphology alone stem from its apparently strongly
reduced habit. All species are tiny, perennial, rhizomatous
herbs, with linear to spathulate, simple, septate leaves. The
inflorescences are few-flowered, simple umbels and the
schizocarp lacks a free carpophore (Affolter 1985). Early
taxonomists tended to regard these characteristics as
indications of relationship to genera in the Hydrocotyloideae
(e.g. Nuttall 1818; Endlicher 1836–1840). Candolle (1829)
also maintained Lilaeopsis (as Crantzia) in his
Hydrocotylinées, but stated that despite the simple
inflorescence, Lilaeopsis might be related to the apioid
genus Oenanthe. Bentham and Hooker (1867) formally
transferred Lilaeopsis (as Crantzia) to the tribe Seselineae,
10.1071/SB01007
1030-1887/02/02181
182
again stressing its resemblance to Oenanthe. Drude (1898),
who provided the classification of the Apiaceae still largely
in use, also placed Lilaeopsis (as Crantzia) close to
Oenanthe in the tribe Apieae (=Ammineae), subtribe
Seselinae. In recent years, a number of phylogenetic analyses
of the Apiaceae and the Araliaceae have been published. On
the basis of morphology, Judd et al. (1994) showed that in
their traditional circumscriptions neither of the families is
monophyletic, but together they form a monophyletic group.
The Saniculoideae was a sister group to the Apioideae and
both subfamilies plus the genus Myodocarpus Brongn. &
Gris (traditionally part of the Araliaceae) form a sister group
to the Hydrocotyloideae. However, the analysis was limited
to only 12 taxa and 18 characters. These characters are easily
scored and a re-analysis of the matrix (incl. Lilaeopsis)
results in an almost unresolved tree. Only two clades, the
Apioideae and the Saniculoideae, both including two taxa,
remain. The unresolved relationships are probably caused by
the character distribution of Lilaeopsis, which combines
character states found in the Apiaceae sensu stricto and in
the Araliaceae (incl. Hydrocotyloideae p.p.). A much denser
taxon sampling is needed in order to substantiate the
morphological analysis.
Several phylogenetic analyses on the basis of molecular
data and including many more taxa have been made, but
none of these analyses include Lilaeopsis. An analysis of
chloroplast rbcL sequence data confirmed the sister group
relationship of the Apioideae and the Saniculoideae, but with
the Hydrocotyloideae being polyphyletic (Plunkett et al.
1996a). The same relationships between Apioideae and
Saniculoideae were revealed by sequence data from another
chloroplast gene, matK (Plunkett et al. 1996b) and by a
combined analysis of both data sets (Plunkett et al. 1997).
The relationships within the Apioideae have been explored
primarily by Downie, Katz-Downie and co-workers by the
use of sequence data from introns of the chloroplast genes
rpoC1 (Downie et al. 1996), rps16 (Downie and KatzDownie 1999; Downie et al. 2000b) and rpl16 (Downie et al.
2000a), the nuclear rDNA internal transcribed spacers (ITS)
(Downie and Katz-Downie 1996; Katz-Downie et al. 1999)
and chloroplast RFLPs (Plunkett and Downie 1999). With
respect to the major clades, these analyses provide largely
congruent results, but discrepancies mainly within the larger
clades exist. These will be addressed whenever relevant to
the present study.
Within the Apioideae, the phylogenies are inconsistent
not only with the tribal classifications of Drude (1898), but
also with more-recent classifications (Koso-Poljansky 1916;
Cerceau-Larrival 1962). Hence, Plunkett et al. (1996b)
coined a series of informal names for clades supported by the
molecular data. In the papers by Downie and co-workers
these names were adopted and will be referred to here.
The present paper aims to demonstrate monophyly of
Lilaeopsis and clarify phylogenetic relationship of the genus
G. Petersen et al.
by providing DNA sequence data from ITS, rbcL, matK and
the rpoC1 intron and including these data in the already
existing comprehensive matrices.
Materials and methods
In the lack of any infrageneric classification of Lilaeopsis three species
were chosen, representing widely different parts of its geographic
range, viz. L. novae-zelandiae from New Zealand (GPL9, origin
unknown, cultivated), L. mauritiana from Mauritius (GPL8,
H. Windeløw s.n., Le Val Nature Park, Mauritius, 5.iii.1992) and the
American L. carolinensis (GPL4, J. Bogner s.n., origin unknown,
cultivated). Voucher specimens are deposited at C. Table 1 lists the
GenBank accession numbers and authors of the species used for
phylogenetic analyses. Table 2 is a summary of morphological
characters and their distribution among taxa that are considered
relevant to the discussion of the relationships of Lilaeopsis. The data
have been extracted from a number of published sources (see Table 2)
and supplemented with personal observations.
Total DNA was extracted from fresh leaves according to the
procedure of Doyle and Doyle (1987). PCR and sequencing were
performed under standard conditions. Products from PCR and cycle
sequencing were purified by the use of the QIAquick PCR Purification
Kit (QIAGEN) according to manufacturers instructions and cycle
sequencing was performed by the use of the ABI PRISM Dye
Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq
DNA Polymerase, FS (PE Biosystems). DNA fragments were separated
on an ABI 377 (PE Biosystems) automated sequencer and sequence
manipulation and/or editing was done with Sequencher 3.0.
For amplification of the first 1200 bp of rbcL we used the primers
RH-1S and Z1204RS for PCR (from G. Zurawski, DNAX Research
Institute, Palo Alto, California, but slightly reduced in length). For
sequencing the primers Hv362R (TGAACCCAAATACGTTACCCA),
Hv522
(TAAACCAAAATTGGGATTA-TCCGC) and Hv890
(TGCATGCAGTTATTGATAGAC) were also used. For amplification
and sequencing of about 1200 bp of matK, we used the primers
matK710F, matK1176F, matK2000R (Plunkett et al. 1996b) and
matK1168R (Johnson and Soltis 1995). For amplification of the rpoC1
intron primers, rpoC1e1 and rpoC1e2R located in the flanking exons
were used for PCR and sequencing and one additional primer, rpoC1i2,
located in the intron, was used for sequencing (Downie et al. 1996). The
amplified products were about 830 bp long. The ITS regions including
5.8S rDNA were amplified with the primers ITS5 L (Hsiao et al. 1994)
and ITS4 (White et al. 1990) and for sequencing, primers ITS2 and
ITS3 (White et al. 1990) were also included. The amplified product is
about 700 bp long.
Phylogenetic analyses were performed in a stepwise procedure.
Initial individual analyses were performed of three relatively large
matrices containing rbcL, matK and rpoC1 intron data. For reasons
given below, the ITS sequences were not initially run alone or combined
with the chloroplast sequences.
The rbcL matrix was compiled from Plunkett et al. (1996a, 1997),
Kondo et al. (1996) and Backlund and Bremer (1997), and included
taxa from Apiaceae, Araliaceae and Pittosporaceae. Pittosporaceae was
included as an outgroup according to its position as a sister group to
Apiales (Plunkett et al. 1996a). The 48 sequences from Plunkett et al.
(1996a) were supplemented with 23 Apiaceae sequences from Kondo
et al. (1996) (only sequences from genera not already represented were
included), plus a single sequence each from Backlund and Bremer
(1997; Steganotaenia Hochst.) and Plunkett et al. (1997;
Cheirodendron Nutt. ex Seem.). The final matrix, including the three
Lilaeopsis sequences, contained 76 taxa and 1428 positions. With no
length difference between the sequences, alignment was
straightforward.
Phylogenetic and taxonomic position of Lilaeopsis
Table 1.
183
GenBank accession numbers for sequences from taxa included in the Oenanthe clade
and used in the phylogenetic analyses
Taxon
matK
Bifora americana (DC.) S.Watson
U58551
Cicuta douglasii (DC.) J.M.Coult. & Rose
U58555
Cicuta virosa L.
—
Cryptotaenia canadensis (L.) DC.
—
(syn. C. japonica Hassk.)
Lilaeopsis carolinensis J.M.Coult. & Rose
AF466270
Lilaeopsis mauritiana G.Petersen & Affolter AF466271
Lilaeopsis novae-zelandiae (Gand.) A.W.Hill AF466272
Neogoezia minor Hemsl.
U58570
Oenanthe javanica DC.
—
Oenanthe pimpinelloides L.
—
rbcL
rpoC1
ITS1/ITS2
—
—
D44561
D44565
—
—
U72447
U72445
AF466267
AF466268
AF466269
U50228
D44577
—
AF466273
AF466274
AF466275
—
—
U72442
—
—
—
U79613/
U79614
AF466276
AF466277
AF466278
—
—
U78371/
U78431
—
—
—
U78373/
U78433
U78400/
U78460
U78370/
U78430
—
—
Oenanthe sarmentosa J.Presl.
Oxypolis occidentalis J.M.Coult. & Rose
Perideridia gairdneri (Hook. & Arn.) Mathias
Perideridia kelloggii (A.Gray) Mathias
U58571
—
U58574
—
—
—
—
—
—
U72444
—
U72446
Shoshonea pulvinata Evert & Constance
U58579
—
U72413
—
—
U72443
—
U58580
D44587
—
—
—
Sium latifolium L.
Sium serra (Franch. & Sav.) Kitag.
Sium suave Walter
The matK matrix was compiled from Plunkett et al. (1996b, 1997),
including taxa from Apiaceae, Araliaceae and Pittosporaceae; the latter
was used as an outgroup. The matrix contained 83 taxa and 1131
positions. Alignment of the full matrix (incl. Lilaeopsis) was
straightforward with gaps (all in frames of three) introduced according
to Plunkett et al. (1996b, 1997).
The rpoC1 intron sequences from Lilaeopsis were included in the
matrix of Downie et al. (1998), kindly provided by S. Downie (UIUC,
Illinois). Inclusion of the Lilaeopsis sequences in the matrix was
unproblematic. The new matrix contained 99 taxa and 952 positions (an
increase of four in comparison to the original). The introduction of two
new gaps (both 2 bp) was unproblematic.
Parsimony jackknifing was used to identify the well-supported
clades found in each of the three matrices using Xac (J. S. Farris,
unpubl. data). With a removal rate of P = e–1, groups that occur with a
frequency higher than c. 67% are supported by at least one
uncontradicted character (Farris et al. 1996). Branches with a jackknife
support between 67 and 50% are expected to have some support. Xac
analyses were performed with the command (1000 */5) allowing 1000
replicates, five random input orders and branch swapping. Only groups
with a jackknife support >50% were retained.
Subsequently, the three chloroplast data sets were combined. In
order to decrease the number of missing entries in the combined matrix,
genera were used as terminals and at least two sequences should be
available for a genus to be included. Whenever sequence data existed
for the same species these were used. If sequences from different
species existed from each of the two or three data sets, the genus was
a priori assumed to be monophyletic and the sequences combined
irrespective of any indications of non-monophyly by the individual
analyses. If two or more sequences from different species existed for the
same data set and none of the species were included in any of the other
data sets, a consensus sequence was constructed. The consensus
sequences were constructed by the use of the IUPAC ambiguity code for
sites with nucleotide variation and question marks were used when
length differences were encountered. The combined matrix contained
72 terminals (genera) and 3452 positions. The number of positions is
lower than the sum of positions in the original matrices as some gaps
were removed due to exclusion of taxa. A phylogenetic analysis was
performed with PAUP*4.0b2a (Swofford 1999) by the use of 100
random addition orders, TBR (tree bisection and regrafting) swapping,
steepest decent and by keeping five trees per step. Parsimony
jackknifing was performed as for analyses of the individual data sets by
the use of Xac.
Whereas sequences from the three chloroplast regions were readily
alignable, the ITS1 and ITS2 sequences from the Apiaceae (Downie
et al. 1998) showed considerable length differences. Downie et al.
(1998) used CLUSTAL V (Higgins et al. 1992) to make a preliminary
alignment (subsequently adjusted manually) of 95 Apiaceae ITS
sequences. The final alignment had a length of 485 positions of which
48 were considered ambiguous and excluded from the phylogenetic
analyses (Downie et al. 1998). The aligned matrix was kindly put at our
disposal. However, we failed to add the Lilaeopsis sequences to this
matrix in an ‘unambiguous manner’ and inspection of the matrix did not
convince us that the original alignment was unambiguous either [see
Downie and Katz-Downie (1996) for a published alignment of 40 taxa].
Hence, no attempts were made to run the chloroplast sequences and the
ITS sequences in a combined analysis.
CLUSTAL V alignments are based on a guide tree which is based
on distance measures, whereas a methodology on the basis of the
principle of optimisation alignment is preferable in a phylogenetic
context (Wheeler 1996). Optimisation alignment is implemented in the
programme POY version 2.0 (Gladstein and Wheeler 2000). POY
analysis is, however, extremely computer intensive and we were only
able to perform it on a subset of the sequences. To select a relevant
subset we used the results from our previous analysis of the combined
chloroplast data. Sequences from all taxa included in the same clade as
184
G. Petersen et al.
Table 2. Morphological characters for taxa included in the Oenanthe clade by one or more cladistic analyses
Data from Coulter and Rose (1900), Drude (1898), Hegi (1926), Constance (1987), Evert and Constance (1982), Hasskarl (1858), Mathias and
Constance (1944–1945), Affolter (1985)
HabitatA Roots
Leaves
Umbels
Simple, linear, septate
Pinnate
Pinnate
Pinnate
Simple
Simple
Compound
Compound
Pinnate/ternate/
simple, linear, septate
Pinnate
Ternate
Digitate/pinnate/
simple, linear, septate
Pinnate
Lilaeopsis Greene
Neogoezia Hemsl.
Bifora Hoffm.
Sium L. s.str.
Wet
Wet
Dry
Wet
Berula Besser & W.D.J.Koch
Wet
Thin, fibrousC
Tuberous fascicled
Slender taproots
Fusiform-thickened/
fibrous fascicled
Fibrous fascicled
Oxypolis Raf.
Wet
Tuberous fascicled
Helosciadium W.D.J.Koch
Cryptotaenia DC.
Cynosciadium DC.
Wet
Dry
Wet
Fibrous
Slender fascicled
Fibrous fascicled
Cicuta L.
Wet
Fibrous/tuberous
Oenanthe L.
fascicled
Wet
Fibrous/tuberous
Pinnate/
simple, linear, septate
Perideridia Rchb.
Dry
Shoshonea Evert
& Constance
Dry
Fusiform/tuberous
fascicled
Woody taproot
Pinnate/ternate/
simple, linear
Pinnate
Pinnate
AerenchymeB
Carpophore
Absent
Free, bipartite or bifid
Free, bipartite
Bipartite, adnate to
the mericarps
Compound Bipartite, adnate to
the mericarps
Compound Free, bipartite
Present
Absent
Absent
Present
Compound Free
Compound Free, bipartite-bifid
Compound Free, bifid
Present
No data
Present
Compound Free, bipartite (but splits
late, also from mericarps)
Compound Bipartite, adnate to the
mericarps (mericarps split
late)
Compound Free, bipartite
Present
Compound Bipartite, adnate to
the mericarps
Present
Absent
Present
Absent
Absent
A
Dry refers to a variety of habitats: woodlands, meadows.
Data collected from text and drawings. Any indication of ‘corky’ or ‘spongy’ tissue has been interpreted as aerenchyme, although it may not
consist of similar cell types.
C
Minor root swellings observed in one species.
B
Lilaeopsis were selected (see Results and Table 1) and the available ITS
sequences (eight) from species belonging to the genera included in this
clade were used in the POY analyses. Only Lilaeopsis was represented
by more than one species. On the basis of its position in the combined
phylogenetic analysis Shoshonea was used as an outgroup. ITS1 and
ITS2 sequences were treated as independent blocks. No external
evidence is available for selecting the necessary parameters used in
POY, e.g. gap versus substitution costs or transversion versus transition
costs, for ITS. Hence, to select a ‘best’ set of costs, a sensitivity analysis
(Wheeler 1995) exploring congruence measured by the ILD
(incongruence-length difference) (Mickevich and Farris 1981) between
the results from separate and combined analyses of ITS1 and ITS2 was
performed. A total of 30 POY analyses with different cost matrices was
performed. Transversion costs of 0.5, 1, 2, 4, 8 and 16 times transition
costs were applied for each of the gap costs of 1, 2, 4, 8 and 16. Each
analysis was performed with the commands: -random 20, -multibuild
20, -checkslop 100, -slop 50, -norandomizeoutgroup. The topological
incongruence-length difference, TILD (Wheeler 1999), was calculated
between all trees obtained from analyses of ITS1 + ITS2 and the
topology of the clade including Lilaeopsis was derived through analysis
of the chloroplast data (with the modification that all species of
Lilaeopsis were included).
Results
The rbcL sequences from the three Lilaeopsis species
contain only eight variable sites. After jackknifing of the
rbcL matrix, including a total of 200 parsimony informative
sites, Lilaeopsis was placed in a largely unresolved clade
with Sium, Cicuta (C. virosa), Cryptotaenia, Oenanthe and
Neogoezia (corresponding to the Oenanthe clade of Plunkett
et al. 1996b) (Fig. 1). The only supported branches in the
clade support monophyly of Lilaeopsis (jackknife
proportions of 99), with L. novae-zelandiae sister group of
Neogoezia
Sium
Cicuta
Cryptotaenia
73
Oenanthe
L. novae-zelandiae
L. mauritiana
99
63
L. carolinensis
Fig. 1. Topology of the Oenanthe clade following parsimony
jackknife analysis of rbcL sequence data. Numbers below branches
are jackknife support values. L. = Lilaeopsis.
Phylogenetic and taxonomic position of Lilaeopsis
the other two species. Only the Oenanthe clade is shown in
Fig. 1 and in subsequent figures. The jackknife trees
produced here are largely similar but less-resolved than the
trees already shown in the publications presenting the
original sequence data. The complete jackknife trees are
available at www.bot.ku.dk/groups/monocot/.
The matK sequences from the three species of Lilaeopsis
contain a total of 10 variable sites. Analysis of the matK
matrix, including a total of 336 parsimony informative sites,
also placed Lilaeopsis in the Oenanthe clade (Fig. 2).
Cryptotaenia, which was placed in the Oenanthe clade by the
rbcL data, was not included in the matK analysis. The genus
Cicuta, here represented by C. douglasii, is not a member of
the Oenanthe clade, but is placed in the Angelica clade sensu
Plunkett et al. (1996b). Bifora, Shoshonea and Perideridia
are new members of the clade, with respect to the rbcL
analysis in which none of the genera were represented. The
clade is well-resolved and most branches are very well
supported. The monophyly of Lilaeopsis is confirmed
(jackknife proportions of 100) and again L. novae-zelandiae
is placed as the sister group of the other species.
The rpoC1 intron sequences from the three species of
Lilaeopsis contain 11 variable sites (10 substitutions and one
1-bp indel). Analysis of the rpoC1 matrix, including a total
of 272 parsimony informative sites, again placed Lilaeopsis
in the Oenanthe clade (Fig. 3), together with Perideridia,
Oenanthe, Cicuta (C. virosa), Sium, Cryptotaenia and
Oxypolis. The latter genus was not represented in any of the
previous analyses. Shoshonea, which was placed in the
Oenanthe clade by the matK data, is not included in this clade
according to the analysis of the rpoC1 intron data. Bifora and
Neogoezia included in the rbcL or matK matrices were not
included in this analysis. The Oenanthe clade is only
moderately resolved, but Lilaeopsis remains monophyletic
185
Perideridia
Oenanthe
Cicuta
81
Sium
52
Oxypolis
75
Cryptotaenia
L. novae-zelandiae
L. mauritiana
100
98
L. carolinensis
Fig. 3. Topology of the Oenanthe clade following parsimony
jackknife analysis of rpoC1 intron sequence data. Numbers below
branches are jackknife support values. L. = Lilaeopsis.
(jackknife proportions of 100) again with L. novae-zelandiae
being the sister group to the other species.
Phylogenetic analysis of the combined matrix resulted in
more than 57 900 equally parsimonious trees (length = 1635,
ci = 0.50, ri = 0.83). Although the trees were distributed on
three islands (Maddison 1991), the topological differences
between the consensus trees constructed from each of the
islands reside in a large clade, including Araliaceae and part
of the Hydrocotyloideae only. Lilaeopsis was placed in a
clade together with Cryptotaenia, Sium, Neogoezia,
Oenanthe, Perideridia and Shoshonea (Fig. 4). Shoshonea
was placed as the sister group to the remaining taxa in the
clade, but this position did not have jackknife support above
50%. Cicuta (C. virosa and C. douglasii combined) was
Perideridia
97
75
Oenanthe
Shoshonea
Shoshonea
Perideridia
67
78
Sium
Oenanthe
Bifora
Cryptotaenia
79
98
Neogoezia
86
89
Neogoezia
L. novae-zelandiae
94
L. mauritiana
100
88
L. carolinensis
Fig. 2. Topology of the Oenanthe clade following parsimony
jackknife analysis of matK sequence data. Numbers below branches
are jackknife support values. L. = Lilaeopsis.
Sium
Lilaeopsis
Fig. 4. Topology of the Oenanthe clade in the strict consensus tree
(length = 1635, ci = 0.50, ri = 0.83) based on more than 57 900
equally parsimonious trees reconstructed from a combined
phylogenetic analysis of data from three chloroplast sequences.
Numbers below branches are jackknife support values.
186
G. Petersen et al.
placed as a sister group to a larger clade including 19 other
Apioideae genera. Oxypolis and Bifora were not included in
the combined analyses as data from only one gene were
available for each. The complete consensus tree is available
at www.bot.ku.dk/groups.monocot/.
One ITS1 and ITS2 sequence from each of the genera
Cryptotaenia, Sium, Oenanthe, Perideridia and Shoshonea
plus the three Lilaeopsis sequences were included in POY
analyses. Following the previously described search strategy,
most analyses recovered the shortest tree(s) in all of the
20 replicates and never in fewer than five of them. The
lowest ILD value (0.00459) was obtained at a transversion : transition cost of 2 : 1 and a gap cost of 1.
Optimisation alignment of ITS1 + ITS2 under these costs
resulted in only one tree (Fig. 5a).
A
Shoshonea
Perideridia
Cryptotaenia
Sium
Oenanthe
L. carolinensis
L. mauritiana
L. novae-zelandiae
B
Shoshonea
Perideridia
Cryptotaenia
Sium
Oenanthe
L. novae-zelandiae
L. mauritiana
L. carolinensis
Fig. 5. Topologies of the Oenanthe clade according to optimisation
alignment of ITS1 and ITS2 sequences. (A) Topology obtained with
the cost matrix TV: TS : gap 2 : 1 : 1 minimising ILD between ITS1
and ITS2. (B) Topology obtained with cost matrices TV : TS : gap
1 : 2 : 8, 2 : 1 : 2, 4 : 1 : 2, 8 : 1 : 4, 16 : 1 : 8 minimising TILD between
topologies obtained from ITS and the combined chloroplast data.
L. = Lilaeopsis.
Under the 30 different cost functions, only nine different
trees were found from analyses of ITS1 + ITS2. None of
these were congruent with the topology of the tree derived
through combined analysis of the three chloroplast genes and
the only clade in common between all nine trees was a
monophyletic Lilaeopsis. The lowest TILD value (0.0769;
TILDN = 0.0588) was for a tree (Fig. 5b) obtained by the use
of several cost matrices (TV : TS : 3gap 1 : 2 : 8, 2 : 1 : 2,
4 : 1 : 2, 8 : 1 : 4, 16 : 1 : 8). This tree differs from the tree
obtained by the use of the 2 : 1 : 1 cost matrix by the
resolution within Lilaeopsis only.
Discussion
Applicability of ITS for phylogenetic reconstruction
Under the assumption that the ITS sequences included in the
present analyses are homologous, i.e. the copies have been
completely homogenised, it should be possible to make
homology statements for every site included in the
sequences. However, a very large number of different
hypotheses of positional homology (alignments) can be
made and our possibilities for objectively choosing any one
as ‘the best’ are very limited. Computer programmes
performing multiple alignment or optimisation alignment
remove part of the subjectivity that burdens manual
alignments and manually adjusted alignments. However, the
choice of cost matrices is still subjective. Hence,
alternatively, cost matrices specifying a broader spectrum of
different evolutionary patterns observed in other sequences
or other organisms may form the basis of a sensitivity
analysis by testing the robustness of the resulting tree
topology when the underlying cost matrix is perturbed
(Wheeler 1995; Phillips et al. 2000). If alternative evidence
exists for the phylogeny of a given group, congruence
between this phylogeny and the trees constructed with
different cost matrices may be used as a means of selecting
the best estimate of the underlying evolutionary pattern. This
approach is, however, not free from shortcomings. Any real
conflict between data sets, e.g. conflict between nuclear and
chloroplast data caused by hybridisation, will be hidden.
In the present case, we observe that the tree topologies
obtained by the ITS data are sensitive to changes in the cost
matrix and that monophyly of Lilaeopsis is the only
resolution shared between the trees. No cost matrix results in
a tree congruent with the tree derived the combined
chloroplast data. Because of assumed differences in the
evolutionary constraints on ITS and the chloroplast
sequences, ILD tests have not been performed. In the
protein-coding genes rbcL and matK, only indels
maintaining the reading frame (i.e. in multiples of three)
occur (in rbcL, no length variation is observed at all) and in
the rpoC1 intron, most length differences seem to be caused
by smaller, 1–7-bp duplications. No such simple patterns are
discernable in the ITS sequences. In the present
Phylogenetic and taxonomic position of Lilaeopsis
implementation of POY, different data sets have to be
analysed by the use of the same cost matrix; consequently,
simultaneous analyses of ITS and the chloroplast sequences
have not been attempted.
As an alternative, two different strategies were followed.
First, an ILD test was performed with ITS1 and ITS2 treated
as independent data sets. The ITS1 and ITS2 sequences are
likely to evolve according to the same pattern (Baldwin et al.
1995) and ILD values are indeed very low for all sets of cost
(data not shown). The cost matrix resulting in the lowest ILD
value has a moderate TV : TS cost ratio (2 : 1) and a low gap
cost (1). Second, congruence between the topologies on the
basis of ITS under different costs and the topology obtained
from the combined analyses of the three chloroplast data sets
(Fig. 4) was explored by the use of the TILD, which avoids
the problems of weight functions and differences in taxon
sampling. This approach showed that a single tree (Fig. 5b),
obtained by the use of a number of different cost matrices,
was most congruent with the chloroplast-based tree. The tree
differs from the one obtained by the 2 : 1 : 1 cost matrix only
by topology of the Lilaeopsis clade.
The latter approach assumes a priori that the topology
constructed from the chloroplast data is preferable, but this
assumption may of course be wrong. If, instead, any of the
nine topologies derived from the ITS data was assumed to
represent the ‘true phylogeny’, it would be equally relevant
to explore topological congruence between this and the
topologies derived under different weighting schemes
applied to the chloroplast data. However, this approach has
not been followed as most of the weights used in analyses of
the ITS data lie far beyond empirically derived weighting
schemes for chloroplast data. For example, for rbcL and
rpoA, the estimated transition : transversion bias resulted in
no more than a 1.2 upweighting of transversions (Albert
et al. 1993; Petersen and Seberg 1997).
The problems handling the ITS data even within the
Oenanthe clade have far-reaching implications for the
reliability of the phylogenetic implications drawn from the
analyses of higher taxonomic levels in the Apiaceae on the
basis of ITS (e.g. Valiejo-Roman et al. 1998; Katz-Downie
et al. 1999; Downie et al. 2000b). Therefore, any reference
below to relationships suggested by ITS analyses should be
treated with caution.
The distribution of morphological characters in the
Oenanthe clade
Despite the differences in phylogenetic relationships
suggested by the ITS data and the chloroplast data, the lack
of full resolution in some of the phylogenetic trees presented
here and the uncertainty about the inclusion of some taxa in
the Oenanthe clade, it is still possible to discuss some of the
more or less unusual morphological character traits possessed
by Lilaeopsis and other members of the clade. The characters
relevant to the following discussion are listed in Table 2.
187
Downie et al. (2000a) characterised the Oenanthe clade
as consisting of glabrous plants with clusters of tubers or
tuberous roots, often growing in wet or moist habitats. Truly,
all the presently recognised members of the clade are
glabrous or almost so, as are most taxa in the Apiaceae. The
more- or less-thickened, often fascicled roots also occur in
many taxa outside the Oenanthe clade and thin, fibrous roots
are not uncommon within the clade, even if the questionable
members (see below) are excluded. The preference for wet or
even truly aquatic habitats is more pronounced, especially as
the inclusion of Bifora and Shoshonea in the Oenanthe clade
may be questioned (see below).
A number of morphological traits of limited occurrence in
the Apioideae characterise some members of the Oenanthe
clade. The linear, septate leaves of Lilaeopsis and other taxa
in the clade are usually interpreted as homologous to the
rachis of a normal compound leaf and the position of septae
corresponds to the position of pinnae in compound leaves
(Kaplan 1970; Charlton 1992). According to Affolter (1985),
similar leaves can be found in the genera Cynosciadium,
Eryngium L., Limnosciadium Mathias & Constance,
Oenanthe, Ottoa Humb., Bonpl., & Kunth, Oxypolis,
Perissocoeleum Mathias & Constance and Ptilimnium Raf.
Affolter (1985) suggested that this trait had evolved
repeatedly in the Apiaceae. Obviously, the simple leaves
found in Eryngium, which by all available evidence belongs
to the Saniculoideae (e.g. Plunkett et al. 1997; Downie et al.
2000a), are not homologous to the simple leaves found in
members of the Oenanthe clade. The following question
remains then: how many of these genera belong to the
Oenanthe clade. Both according to the present (Fig. 3) and
previous phylogenetic analyses of rpoC1 intron data (Downie
et al. 1998) and according to analyses of other chloroplast
regions (Downie et al. 2000a), Oxypolis is a member of the
Oenanthe clade. On the basis of unpublished data, Downie
et al. (2000a) provided phylogenetic evidence also for the
inclusion of Cynosciadium in the Oenanthe clade. This genus
comprises wetland species with aerenchymatic tissue in the
mericarp, but with free carpophores (see below). Also
Ptilimnium and Limnosciadium are strong candidates for
inclusion in the Oenanthe clade and Downie et al. (2000a,
2001) include both genera in the Oenanthe clade. However,
they do not provide any data supporting the inclusion. Both
genera consist of glabrous, annual, wetland species with
pinnate or simple leaves, compound umbels, free bifid
carpophores and aerenchymatic tissue in the mericarps and
they are usually considered closely related to Cynosciadium
(Limnosciadium was originally included in Cynosciadium).
However, Perissocoeleum and Ottoa are less-likely
candidates for inclusion in the Oenanthe clade. The South
American genus Perissocoeleum consists of glabrous or
pubescent perennials, with either linear, septate (one species)
or pinnately decompound (three species) leaves, compound
umbels and a free, bipartite carpophore (Mathias and
188
Constance 1952, 1967). The mericarps do not posses
aerenchymatic tissue and the fruit is described as
‘peucedanoid’ by Mathias and Constance (1952).
Perissocoeleum is more likely a member of the Angelica
clade. The monotypic Central American Ottoa is a glabrous
perennial with fusiform roots, simple, septate leaves and a
free bipartite carpophore (Mathias and Constance
1944–1945). Information about the texture of the fruits is
unavailable. Although originally placed next to Oenanthe
(Humboldt et al. 1815–1825), Coulter and Rose (1895)
considered Ottoa related to Arracacia Bancr., which,
although being non-monophyletic, is a member of the
Angelica clade (e.g. Downie et al. 2000a). Hence, Affolter
(1985) was probably correct in postulation that the linear,
septate leaves had evolved repeatedly. Even within the
Oenanthe clade, linear, septate leaves cannot be considered a
synapomorphy for any subset of taxa; on the contrary, the
reduction from pinnate to simple leaves must have occurred
several times. It is likely that the linear leaves are an
adaptation to an aquatic or semi-aquatic environment,
although in some species (Perideridia) only the upper leaves
are reduced.
Presence of simple umbels characterises the
Hydrocotyloideae and the Saniculoideae, but is extremely
rare in the Apioideae. Apart from Lilaeopsis, the only apioid
genera with simple umbels are Neogoezia, Oreomyrrhis
Endl. and possibly Naufraga Constance & Cannon
(Constance and Cannon 1967; Constance 1987; Downie
et al. 2000b). According to the present phylogenetic
analyses, the Mexican genus Neogoezia may be the sister
group to Lilaeopsis (Fig. 4). This relationship is strongly
supported by the shared presence of simple umbels. The
monotypic, Balearic endemic Naufraga was originally
included in the Hydrocotyloideae because of the simple
umbel and complete lack of carpophore (Constance and
Cannon 1967) and a recent phylogenetic analysis on the
basis of morphological characters places Naufraga within
Hydrocotyloideae (Henwood and Hart 2001). However,
analyses of rps16 and ITS data place Naufraga as the sister
group to Apium graveolens L. in the Apium clade (Downie
et al. 2000b). The inflorescence of Apium L. s.str. is a sessile
umbel, lacking involucre, but subtended by stem leaves.
Given their position as sister groups, the Naufraga
inflorescence may be interpreted in the same way. The
typical Gwondanan distribution of the genus Oreomyrrhis
largely resembles that of Lilaeopsis and Drude (1898)
placed Oreomyrrhis next to Neogoezia. However, in their
monograph of the genus, Mathias and Constance (1955,
p. 349) did not consider Oreomyrrhis closely related to any
other genus with simple umbels, but ‘having a vague
relationship to Chaerophyllum’, which according to the
molecular analyses is a member of a monophyletic group
within the Daucus clade, corresponding quite closely to
Drude’s Scandiceae, subtribe Scandicinae (Downie et al.
G. Petersen et al.
2000a). Ongoing molecular studies seem to confirm a close
relationship to Chaerophyllum (Kuo-fang Chung, WU,
Missouri, pers. comm.). The species of Oreomyrrhis are
alpine, occasionally wetland perennials with taproot,
glabrous to tomentose pinnate or simple leaves, a free
bipartite or bifid carpophore and mericarps ‘sometimes
slightly corky’ (Mathias and Constance 1955, p. 355). The
simple leaves possessed by two species from New Guinea
are not septate, but they may have a number of incurved,
often opposite teeth at the apex, which may suggest that they
are reduced forms of pinnate leaves consisting primarily of
the petiole. Whether the corky tissue in the mericarps is
similar to the aerenchyma found in Lilaeopsis remains
unknown (see below). But given the more likely relationship
to Chaerophyllum, there is little evidence for the inclusion
of Oreomyrrhis in the Oenanthe clade.
The lack of a free carpophore is not common in the
Apiaceae. The Hydrocotyloideae is characterised by the lack
of a free carpophore, but in the remaining subfamilies the
character state is rare. However, in the Oenanthe clade
several genera have an either poorly developed (Oenanthe)
or entirely lacking carpophore (Lilaeopsis, Shoshonea) or a
carpophore that is bipartite with the halves more or less
strongly adnate to the mericarps (Sium, Berula and
Shoshonea) (Drude 1898; Hegi 1926; Mathias and
Constance 1944–45; Evert and Constance 1982). According
to Hegi (1926), Cicuta has a free, bipartite carpophore,
which, however, splits only reluctantly from the mericarps.
Several members of the Oenanthe clade have free, bipartite
or bifid carpophores as do most apioid taxa; hence, the
absence of a free carpophore is neither a synapomorphy for
the clade nor for any subset of taxa. Lacking a free
carpophore may be found also outside the Oenanthe-clade
taxa, e.g. Naufraga (Apium clade) and Thaspium Nutt.
(Angelica clade). Thus, reduction of the carpophore or
adnation to the mericarps seem to have occurred several
times during the evolution of the Apioideae.
The presence of aerenchymatic tissue (‘spongy cells’) in
the mericarps was discussed by Affolter (1985), who stated
that this character might be related to habitat preference. The
aerenchymatic tissue enhances the buoyancy of the
mericarps and is primarily, but not exclusively, found in
species occupying wet habitats. The aerenchymatic tissue of
Lilaeopsis consists of storage tracheids (Affolter 1985), but
detailed anatomical studies of the fruits from most other
genera are lacking. Hence, the scoring of aerenchymatic
tissue in Table 2 is based on drawings of fruit transections or
descriptions of the fruits as ‘corky’, ‘schwammig’, or with
‘schwimmgewebe’ and may not reflect homologous
structures. Similar descriptions can be found for a number of
genera outside the Oenanthe clade, but it is possible that the
type of aerenchymatic tissue found in most members of the
Oenanthe clade is different from that found in taxa outside
the clade.
Phylogenetic and taxonomic position of Lilaeopsis
In conclusion, none of the characters discussed above can
be considered a synapomorphy for the Oenanthe clade. In
general, there is only limited agreement between the
traditional taxonomy and the molecular hypotheses for the
entire Apioideae as discussed by Downie and co-workers
(e.g. Downie et al. 2001; Spalik and Downie 2001). A largescale phylogenetic analysis of morphological characters is
highly needed. Mapping the characters on the phylogenetic
hypothesis for the Oenanthe clade presented here seems
premature. A better resolved phylogeny is highly desirable,
more taxa need to be added and there is uncertainty about the
inclusion of some taxa.
Taxa with questionable relationship to the Oenanthe clade
The monotypic genus Shoshonea has been included in the
analyses of matK (Plunkett et al. 1996b), the rpoC1 and
rpl16 introns and ITS (Downie et al. 1998, 2000a). Whereas
matK places Shoshonea in the Oenanthe clade, all other
analyses place Shoshonea within the Angelica clade (Downie
et al. 1998, 2000a), related to a group of primarily western
North American taxa, among which Aletes J.M.Coult. &
Rose, Neoparrya Mathias and Musineon Raf. have been
suggested as close relatives by Evert and Constance (1982).
Extensive incongruence between phylogenies on the basis of
data from the plastids is rare, whereas phylogenies on the
basis of data from different genomes, e.g. plastid versus
nuclear sequences, frequently differ (e.g. Petersen and
Seberg 1997). Plunkett and Downie (1999) considered the
matK results spurious and Shoshonea misplaced in the
Oenanthe clade. This is supported by Shoshonea not being a
wetland plant and by a lack of aerenchymatic tissue in the
mericarps. However, Shoshonea frequently lacks a free
carpophore (Evert and Constance 1982). The relationships
of Shoshonea are in need of further investigation.
The genus Bifora has been included in three of the
molecular studies. The Mediterranean B. radicans is
included in the ITS data set. Another Mediterranean species,
B. testiculata (L.) Spreng. ex Schult., is included in the rps16
data set and the North American B. americana is included in
the matK data set. The ITS and rps16 analyses show
B. radicans as a member of the Angelica clade, whereas
B. testiculata according to the rps16 analysis appears to be a
member of the Apium clade (Downie et al. 1998, 2000b). In
contrast, the matK analysis places B. americana in the
Oenanthe clade as the sister group to Neogoezia, Lilaeopsis
or both (Fig. 2; Plunkett et al. 1996b). If the conflict is real,
Bifora is not monophyletic. Bifora americana is the only
American member of this otherwise Eurasian genus and was
described by Candolle (1829) as Atrema americana DC.,
mainly deviating from the genus Bifora by its prominent
calyx teeth. The presence of a free carpophore, the lack of
aerenchymatic tissue in the mericarps and an overall very
different fruit structure do not indicate relationships to the
Oenanthe clade, but further studies are needed.
189
The genus Cicuta is represented by two different species
in the phylogenetic analyses. Plunkett et al. (1996b) included
the North American C. douglasii in their analysis of the
matK data, whereas the Eurasian C. virosa was included in
the analyses of rbcL (Kondo et al. 1996), the rpoC1 and
rpl16 introns and ITS (Downie et al. 1998, 2000a). All
analyses including C. virosa place the species in the
Oenanthe clade (Kondo et al. 1996; Downie et al. 1998,
2000a) and C. douglasii as a member of the Angelica clade
(Plunkett et al. 1996b). Although Mulligan (1980) proposed
a hybrid origin of C. douglasii, there are no morphological
indications that the genus is non-monophyletic. The genus
Cicuta comprises wetland species with aerenchymatic tissue
in the mericarps (Hegi 1926). Although usually supposed to
have a free carpophore, the mericarps of C. virosa split only
with difficulty from each other and from the carpophore
(Hegi 1926). Hence, the genus seems to fit well into the
Oenanthe clade, but the issue requires further studies.
In addition to the taxa included in the Oenanthe clade in
this study, Downie et al. (1998, 2000b) proposed Berula
(B. erecta (Huds.) Coville and B. thunbergii (DC.) H.Wolff)
and Helosciadium (H. inundatum W.D.J.Koch and
H. nodiflorum W.D.J.Koch) as members of the Oenanthe
clade on the basis of analyses of ITS and the rps16 intron
(Downie et al. 1998, 2000b). These studies also included
Oxypolis, Perideridia, Cryptotaenia, Cicuta, Sium and
Oenanthe in the Oenanthe clade and both Berula and
Helosciadium appear as members of a subclade including
Oxypolis, Cryptotaenia and Sium (Downie et al. 1998,
2000b). Morphologically and ecologically, the two genera fit
well in the Oenanthe clade. Berula is often included in Sium,
with which it shares most of its characteristics. Helosciadium
is often included in Apium s.lat., but according to the
analyses of Downie et al. (2000b), Apium in this sense is
non-monophyletic. Helosciadium comprises wetland species
with aerenchymatic tissue in the mericarps and free
carpophores. Aerenchymatic tissue is not present in Apium
s.str.
Phylogenetic reconstruction within Lilaeopsis
The interspecific relationships in Lilaeopsis are largely
unknown, but all the present phylogenetic analyses confirm
monophyly of the genus. A phylogenetic analysis of the
entire genus is highly desirable. Due to the simple
morphology and the pronounced morphological similarity
between the species, it will probably be possible to use only
a few morphological characters in a phylogenetic analysis.
The genes sequenced in the present study are most likely
sufficiently variable for a phylogenetic analysis of the genus.
The level of variation is low and only marginally different
among the three chloroplast sequences: there are eight
variable sites in rbcL and 11 in rpoC1 and 10 in matK and all
sequences should be included to provide a sufficient number
of characters. As a complement to the chloroplast sequences,
190
nuclear ITS sequences are most likely useful for a
phylogenetic analysis within Lilaeopsis, although their value
for higher-level analyses may be limited. According to the
alignment implied by the cost matrix TV : TS : GAP 2 : 1 : 1,
the three Lilaeopsis species differ at 54 positions. Also
traditional multiple alignment of ITS sequences from
Lilaeopsis seems possible and unambiguous. Given the
uncertain phylogenetic relationships of members of Bifora,
an appropriate outgroup in studies of the phylogeny of
Lilaeopsis could include Neogoezia and other members of
the Oenanthe clade confirmed by multiple studies.
Acknowledgments
We thank Stephen Downie (UIUC, Illinois) for kindly
putting his molecular matrices at our disposal and for
valuable comments and suggestions relating to the
manuscript. Charlotte Hansen and Lisbeth Knudsen
provided skilful technical assistance. The Faculty of Natural
Sciences supported (M. Curie Grant) Gitte Petersen.
References
Albert VA, Chase MW, Mischler BD (1993) Character-state weighting
for cladistic analysis of protein coding DNA sequences. Annals of
the Missouri Botanical Garden 80, 752–766.
Affolter JM (1985) A monograph of the genus Lilaeopsis
(Umbelliferae). Systematic Botany Monographs 6, 1–140.
Backlund A, Bremer B (1997) Phylogeny of the Asteridae s.str. based
on rbcL sequences, with particular reference to the Dipsacales.
Plant Systematics and Evolution 207, 225–254.
Baldwin BG, Sanderson MJ, Porter JM, Wojciechowski MF,
Campbell CS, Donoghue MJ (1995) The ITS region of nuclear
ribosomal DNA: a valuable source of evidence on angiosperm
phylogeny. Annals of the Missouri Botanical Garden 82, 247–277.
Bentham G, Hooker JD (1867) ‘Genera plantarum. Vol. 1.’ (Reeve and
Co.: London)
Candolle AP de (1829) ‘Collection de mémoires pour servir á l’histoire
du règne végétal. 5. Mémoire sur la famille des ombellifères.’
(Treuttel and Würtz: Paris)
Cerceau-Larrival M-Th (1962) Plantules et pollens d’ombelliferes.
Leur intérêt systématique et phylogénique. Mémoires du Muséum
national d’Histoire naturelle, série B, Botanique 14, 1–166.
Charlton WA (1992) The rachis-leaves of Lilaeopsis brasiliensis
(Glaziou) J.M.Affolter (Apiaceae). Botanical Journal of the
Linnean Society 109, 259–280.
Constance L (1987) Neogoezia (Apiaceae), a very distinct and elegant
genus of Mexican Umbelliferae. Opera Botanica 92, 59–71.
Constance L, Cannon JFM (1967) Naufraga—a new genus of
Umbelliferae from Mallorca. Feddes Repertorium 74, 1–4.
Coulter JM, Rose JN (1895) Report on Mexican Umbelliferae, mostly
from the state of Oaxaca, recently collected by C. G. Pringle and
E. W. Nelson. Contributions from the US National Herbarium 3,
289–309.
Coulter JM, Rose JN (1900) Monograph of the North American
Umbelliferae. Contributions from the U. S. National Herbarium 7,
1–256.
Downie SR, Katz-Downie DS (1996) A molecular phylogeny of
Apiaceae subfamily Apioideae: evidence from nuclear ribosomal
DNA internal transcribed spacer sequences. American Journal of
Botany 83, 234–251.
G. Petersen et al.
Downie SR, Katz-Downie DS (1999) Phylogenetic analysis of
chloroplast rps16 intron sequences reveals relationships within the
woody southern African Apiaceae subfamily Apioideae. Canadian
Journal of Botany 77, 1120–1135.
Downie SR, Katz-Downie DS, Cho K-J (1996) Phylogenetic analysis of
Apiaceae subfamily Apioideae using nucleotide sequences from the
chloroplast rpoC1 intron. Molecular Phylogenetics and Evolution 6,
1–18.
Downie SR, Ramanath S, Katz-Downie DS, Llanaas E (1998)
Molecular systematics of Apiaceae subfamily Apioideae:
phylogenetic analyses of nuclear ribosomal DNA internal
transcribed spacer and plastid rpoC1 intron sequences. American
Journal of Botany 85, 563–591.
Downie SR, Katz-Downie DS, Watson MF (2000a) A phylogeny of the
flowering plant family Apiaceae based on chloroplast DNA rpl16
and rpoC1 intron sequences: towards a suprageneric classification
of subfamily Apioideae. American Journal of Botany 87, 273–292.
Downie SR, Watson MF, Spalik K, Katz-Downie DS (2000b)
Molecular systematics of Old World Apioideae (Apiaceae):
relationships among some members of tribe Peucedaneae sensu
lato, the placement of several island-endemic species, and
resolution within the apioid superclade. Canadian Journal of
Botany 78, 506–528.
Downie SR, Plunkett GM, Watson MF, Spalik K, Katz-Downie DS,
Valiejo-Roman CM, Terentieva EI, Troitsky AV, Lee B-Y,
Lahham J, El-Oqlah A (2001) Tribes and clades within Apiaceae
subfamily Apioideae: the contribution of molecular data. Edinburgh
Journal of Botany 58, 301–330.
Doyle JJ, Doyle JF (1987) A rapid DNA isolation procedure for small
quatities of fresh leaf tissue. Phytochemical Bulletin 19, 11–15.
Drude O (1898) Umbelliferae. In ‘Die natürlichen Pflanzenfamilien,
vol. 3(8)’. (Eds A Engler, K Prantl) pp. 63–250. (Wilhelm
Engelmann Verlag: Leipzig)
Endlicher SL (1836–1840) ‘Genera plantarum secundum ordines
naturales disposita.’ (Fr Beck: Vienna)
Evert EF, Constance L (1982) Shoshonea pulvinata, a new genus and
species of Umbelliferae from Wyoming. Systematic Botany 7,
471–475.
Farris JS, Albert VA, Källersjö M, Lipscomb D, Kluge AG (1996)
Parsimony jackknifing outperforms neighbor-joining. Cladistics
12, 99–124.
Gladstein D, Wheeler WC (2000) ‘POY. Phylogeny reconstruction via
direct optimization of DNA data. Version 2. 0.’ (American Museum
of Natural History: New York)
Greene EL (1891) Against the using of revertible generic names.
Pittonia 2, 185–195.
Hasskarl JK (1858) ‘Hortus bogoriensis descriptus.’ (F. Günst:
Amsterdam)
Hegi G (1926) ‘Illustrierte Flora von Mittel-Europa, vol. 5(2).’
(J. F. Lehmannns Verlag: München)
Henwood MJ, Hart JM (2001) Towards an understanding of the
relationships of Australian Hydrocotyloideae (Apiaceae).
Edinburgh Journal of Botany 58, 269–289.
Higgins DG, Bleasby AJ, Fuchs R (1992) CLUSTAL V: improved
software for multiple sequence alignment. Computer Applications
in the Biosciences 83, 189–191.
Hsiao C, Chatterton NJ, Asay KH, Jensen KB (1994) Phylogenetic
relationships of 10 grass species: an assessment of phylogenetic
utility of the internal transcribed spacer region in nuclear ribosomal
DNA in monocots. Genome 37, 112–120.
Humboldt A von, Bonpland A, Kunth CS (1815–1825) ‘Nova genera et
species plantarum.’ (Librariae graeco-latini-germanicae: Paris)
Humphries CJ, Parenti LR (1999) ‘Cladistic biogeography. Interpreting
patterns of plant and animal distributions. 2nd Edn.’ (Oxford
University Press: Oxford)
Phylogenetic and taxonomic position of Lilaeopsis
191
Johnson LA, Soltis DE (1995) Phylogenetic inference in Saxifragaceae
sensu stricto and Gilia (Polemoniaceae) using matK sequences.
Annals of the Missouri Botanical Garden 82, 149–175.
Judd WS, Sanders RW, Donoghue MJ (1994) Angiosperm family pairs:
preliminary phylogenetic analyses. Harvard Papers in Botany 5,
1–51.
Kaplan DR (1970) Comparative development and morphological
interpretation of ‘rachis-leaves’ in Umbelliferae. Botanical Journal
of the Linnean Society 63 (suppl. 1), 101–125.
Katz-Downie DS, Valiejo-Roman CM, Terentieva EI, Troitsky AV,
Pimenov MG, Lee B, Downie SR (1999) Towards a molecular
phylogeny of Apiaceae subfamily Apioideae: additional
information from nuclear ribosomal DNA ITS sequences. Plant
Systematics and Evolution 216, 167–195.
Kondo K, Terabayashi S, Okada M, Yuan C, He S (1996) Phylogenetic
relationships of medically important Cnidium officinale and
Japanese Apiaceae based on rbcL sequences. Journal of Plant
Research 109, 21–27.
Koso-Poljansky BM (1916) Sciadophytorum systematis lineamenta.
Bulletin de la Société impériale des Naturalistes (Moscou) 29,
93–222.
Linder HP, Crisp MD (1995) Nothofagus and Pacific biogeography.
Cladistics 11, 5–32.
Linnaeus C (1753) ‘Species plantarum.’ (L. Salvii: Stockholm)
Maddison D (1991) The discovery and importance of multiple islands
of most parsimonious trees. Systematic Zoology 40, 315–328.
Mathias ME, Constance L (1944–1945) Umbelliferae. In ‘North
American flora. Vol. 28B’. pp. 43–295. (New York Botanical
Garden: New York)
Mathias ME, Constance L (1952) New South American Umbelliferae.
Bulletin of the Torrey Botanical Club 79, 359–370.
Mathias ME, Constance L (1955) The genus Oreomyrrhis
(Umbelliferae). A problem in South Pacific distribution. University
of California Publications in Botany 27, 347–416.
Mathias ME, Constance L (1967) Some Umbelliferae of the Andean
paramos of South America. Brittonia 19, 212–226.
Mickevich MF, Farris JS (1981) The implications of congruence in
Menidia. Systematic Zoology 30, 351–370.
Mulligan GA (1980) The genus Cicuta in North America. Canadian
Journal of Botany 58, 1755–1767.
Nuttall T (1818) ‘The genera of North American plants. 2 vols.’
(D. Heart: Philadelphia)
Petersen G, Affolter J (1999) A new species of Lilaeopsis (Apiaceae)
from Mauritius. Novon 9, 92–94.
Petersen G, Seberg O (1997) Phylogenetic analysis of the Triticeae
(Poaceae) based on rpoA sequence data. Molecular Phylogenetics
and Evolution 7, 217–230.
Phillips A, Janies D, Wheeler W (2000) Multiple sequence alignment
in phylogenetic analysis. Molecular Phylogenetics and Evolution
16, 317–330.
Plunkett GM, Downie SR (1999) Major lineages within Apiaceae
subfamily Apioideae: a comparison of chloroplast restriction site
and DNA sequence data. American Journal of Botany 86,
1014–1026.
Plunkett GM, Soltis DE, Soltis PS (1996a) Higher level relationships of
Apiales (Apiaceae and Araliaceae) based on phylogenetic analysis
of rbcL sequences. American Journal of Botany 83, 499–515.
Plunkett GM, Soltis DE, Soltis PS (1996b) Evolutionary patterns in
Apiaceae: inferences based on matK sequence data. Systemtic
Botany 21, 477–495.
Plunkett GM, Soltis DE, Soltis PS (1997) Clarification of the
relationship between Apiaceae and Araliaceae based on matK and
rbcL sequence data. American Journal of Botany 84, 565–580.
Raynal J (1977) Le genre Lilaeopsis (Ombelliferes) à Madagascar.
Adansonia 17, 151–154.
Spalik K, Downie SR (2001) The utility of morphological characters
for inferring phylogeny in Scandiceae subtribe Scandicinae
(Apiaceae). Annals of the Missouri Botanical Garden 88, 270–301.
Swofford DL (1999) ‘PAUP* 4. 0b2a: phylogenetic analysis using
parsimony (*and other methods).’ (Sinauer Associates:
Sunderland, MA)
Valiejo-Roman KM, Pimenov MG, Terentieva EI, Downie SR, KatzDownie DS, Troitsky AV (1998) Molecular stystematics of the
Umbelliferae: using nuclear ribosomal DNA internal transcribed
spacer sequences to resolve issues of evolutionary relationships.
Botanicheskii Zhurnal 83, 1–22.
Wheeler WC (1995) Sequence alignment, parameter sensitivity, and the
phylogenetic analysis of molecular data. Systematic Biology 44,
321–331.
Wheeler WC (1996) Optimization alignment: the end of multiple
sequence alignment in phylogenetics? Cladistics 12, 1–9.
Wheeler W (1999) Measuring topological congruence by extending
character techniques. Cladistics 15, 131–135.
White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In
‘PCR protocols: a guide to methods and applications’. (Eds
MA Innis, DH Gelfand, JJ Sninsky, TJ White) pp. 315–322.
(Academic Press: San Diego)
Manuscript received 9 April 2001, accepted 8 November 2001
http://www.publish.csiro.au/journals/asb