Neotropical Ichthyology Original article https://doi.org/10.1590/1982-0224-2021-0095 Cryptic speciation in populations of the genus Aphyocharax (Characiformes: Characidae) from eastern Amazon coastal river drainages and surroundings revealed by single locus species delimitation methods Correspondence: Pâmella Silva de Brito pamellabrito@hotmail.com Submitted May 26, 2021 Accepted August 18, 2021 by Carlos DoNascimiento Epub December 10, 2021 Pâmella S. Brito1,2, Erick C. Guimarães1,2, Karen L. A. Guimarães2, Luís R. R. Rodrigues2, Marcelo R. Anjos3, Axel M. Katz4, Luis F. Carvalho-Costa1 and Felipe P. Ottoni5 Recent studies in eastern Amazon coastal drainages and their surroundings have revealed new fish species that sometimes exhibit little morphological differentiation (cryptic species). Thus, we used a DNA-based species delimitation approach to test if populations showing the morphotype and typical character states of the Aphyocharax avary holotype correspond either to A. avary or A. brevicaudatus, two known species from the region, or if they form independent lineages, indicating cryptic speciation. WP and GMYC analyses recovered five lineages (species) in the ingroup, while a bPTP analysis delimited three lineages. ABGD analyses produced two possible results: one corroborating the WP and GMYC methods and another corroborating the bPTP method. All methods indicate undescribed cryptic species in the region and show variation from at least 1 to 4 species in the ingroup, depending on the approach, corroborating previous studies, and revealing this region as a possible hotspot for discovering undescribed fish species. Keywords: ABGD, Aphyocharacinae, bPTP, Cryptic speciation, GMYC. 1 Universidade Federal do Maranhão, Departamento de Biologia, Laboratório de Genética e Biologia Molecular, Av. dos Portugueses 1966, Cidade Universitária do Bacanga, 65080-805 São Luís, MA, Brazil. (PSB) pamellabrito@hotmail.com (corresponding author), (ECG) erick.ictio@yahoo.com.br, (LFCC) lfecc@yahoo.com.br. Online version ISSN 1982-0224 Print version ISSN 1679-6225 Neotrop. Ichthyol. vol. 19, no. 4, Maringá 2021 2 Universidade Federal do Oeste do Pará, Laboratório de Genética & Biodiversidade, Instituto de Ciências da Educação, Campus Tapajós, Rua Vera Paz S/N, 68040-255 Santarém, PA, Brazil. (KLA) karen.guimaraes.bio@gmail.com, (LRRR) luisreginaldo.ufpa@hotmail.com. 3 Universidade Federal do Amazonas, Laboratório de Ictiologia e Ordenamento Pesqueiro do Vale do Rio Madeira, R. Vinte Nove de Agosto 786, Centro, 69800-000 Humaitá, AM, Brazil. anjos@ufam.edu.br. 4 Universidade Federal do Rio de Janeiro, Laboratório de Sistemática e Evolução de Peixes Teleósteos, Departamento de Zoologia, Instituto de Biologia, Cidade Universitária, 21941-599 Rio de Janeiro, RJ, Brazil. axelmk@gmail.com. 5 Universidade Federal do Maranhão, Centro de Ciências Agrárias e Ambientais, Laboratório de Sistemática e Ecologia de Organismos Aquáticos, BR-222, Km 04, S/N, Boa Vista, 65500-000 Chapadinha, MA, Brazil. felipe.ottoni@ufma.br. Neotropical Ichthyology, 19(4): e210095, 2021 1/18 Cryptic speciation of the genus Aphyocharax Estudos recentes nas drenagens costeiras da Amazônia oriental e seus arredores revelaram novas espécies de peixes que às vezes exibem pouca diferenciação morfológica (espécies crípticas). Assim, usamos uma abordagem de delimitação de espécies baseada em DNA para testar se as populações que apresentam o morfotipo e os estados de caráter típicos do holótipo Aphyocharax avary correspondem a A. avary ou A. brevicaudatus, duas espécies conhecidas da região, ou se formam linhagens independentes, indicando especiação críptica. As análises de WP e GMYC recuperaram cinco linhagens (espécies) no grupo interno, enquanto uma análise de bPTP delimitou três linhagens. As análises ABGD produziram dois resultados possíveis: um corroborando os métodos WP e GMYC e outro corroborando o método bPTP. Todos os métodos indicam espécies crípticas não descritas na região e apresentam variação de pelo menos uma a quatro espécies no grupo interno, dependendo da abordagem, corroborando estudos anteriores, e revelando esta região como um possível “hotspot” para descoberta de espécies de peixes não descritas. Palavras-chave: ABGD, Aphyocharacinae, bPTP, Especiação críptica, GMYC. INTRODUCTION Speciation is not always accompanied by changes in morphology (= cryptic speciation), making it difficult to identify species using superficial morphological differentiation (Bickford et al., 2006; Adams et al., 2014; Ottoni et al., 2019). However, DNA-based tools help to identify cryptic speciation events and have been increasingly used in species descriptions and diagnoses (Goldstein, DeSalle, 2010; Pante et al., 2015; Souza et al., 2018; Ottoni et al., 2019; Ochoa et al., 2020; Souza et al., 2020). In this case, DNA lineages that diverged from an ancestral branch and evolved independently, as observed in differentiated species, must be named according to specific nomenclature codes used by the scientific community. Aphyocharax Günther, 1868 (Aphyocharacinae) is a monophyletic, small-sized fish genus that comprises 12 valid species (Tagliacollo et al., 2012; Betancur-R. et al., 2018; Mirande, 2018; Brito et al., 2019) distributed in the Orinoco, Amazonas and La Plata river basins, as well as in coastal rivers that drain the Guiana Shield (Tagliacollo et al., 2012; Brito et al., 2018, 2019). Aphyocharax brevicaudatus Brito, Guimarães, CarvalhoCosta & Ottoni, 2019 is the most recently described species (Brito et al., 2019) that inhabits the Maracaçumé River basin, an eastern Amazon costal drainage in the state of Maranhão, in northeastern Brazil. The phylogenetic status of Aphyocharax is well established, but its internal relationships are not fully resolved (e.g., Tagliacollo et al., 2012; Brito et al., 2019). There are at least four putative species in the genus that are not yet described (see Buckup et al., 2007; Brito et al., 2019), and the identification and taxonomic status of several populations and species are still unclear (Lima et al., 2013; Ohara et al., 2017; Brito et al., 2018, 2019). In the last decades, most publications about Aphyocharax have focused on ecology or distribution (e.g., Gonçalves et al., 2005; Corrêa et al., 2009; Terán et al., 2016), cytogenetic characterization (e.g., Souza et al., 1995) or phylogeny (e.g., Tagliacollo 2/18 Neotropical Ichthyology, 19(4): e210095, 2021 ni.bio.br | scielo.br/ni Pâmella S.Brito, Erick C. Guimarães, Karen L.A. Guimarães, Luís R.R. Rodrigues, Marcelo R. Anjos, Axel M.Katz, Luis F. Carvalho-Costa and Felipe P. Ottoni et al., 2012). However, few studies have focused on the species-level taxonomy of Aphyocharax, such as the single taxonomic revision of the genus (an unpublished thesis, Souza-Lima, 2003), some species descriptions (e.g., Taphorn, Thomerson, 1991; Willink et al., 2003; Brito et al., 2019), and some taxonomic works (e.g., Souza-Lima, 2003; Brito et al., 2018). Moreover, the taxonomic status of some Aphyocharax species is questionable and problematic. The imprecise definition of the type locality of several species, old, and change, to and brief morphological descriptions and diagnoses, and confusing taxonomic histories contribute to the problematic taxonomy of this group (Brito et al., 2018). Previous studies indicate the occurrence of several populations of Aphyocharax in the coastal basins of the eastern Amazon and surroundings at the state limits of Pará and Maranhão (see Souza-Lima, 2003; Barros et al., 2011; Guimarães et al., 2020a). These populations have the morphotype and typical character states of the holotype of Aphyocharax avary Fowler, 1913, as described and discussed by Brito et al. (2018). However, A. avary is a species with an imprecise type locality in the Madeira River drainage of the Amazon River basin, with vague distribution records (Brito et al., 2018; Dagosta, de Pinna, 2019), and requires a comprehensive taxonomic revision. According to Guimarães et al. (2018a) the river systems in northeastern Brazil, particularly the river basins of the occidental portion (including the region between Rio Gurupi and the Parnaíba basin), exhibit a diversified but poorly explored freshwater fish fauna that is interpreted in different ways in studies based on the distribution patterns of species (e.g., Hubert, Renno, 2006; Abell et al., 2008; Abreu et al., 2019). This region is herein termed “eastern Amazon coastal river basins”. Recent studies exemplify the great diversification between coastal basins of Maranhão State, as well as the lack of knowledge about the fish in these areas (e.g., Guimarães et al., 2018a,b; Abreu et al., 2019; Brito et al., 2019; Guimarães et al., 2019; Abreu et al., 2020; Guimarães et al., 2020a). In the river drainages of the state of Maranhão (Itapecuru, Mearim, Munim, and Tocantins River draineages), there are several populations with superficial morphology similar to A. avary. In this context, we combined newly generated mitochondrial sequences with those generated by Oliveira et al. (2011) and Tagliacollo et al. (2012) to study species diversity and delimit species boundaries within Aphyocharax from several coastal basins in the eastern Amazon coastal river basins and surroundings. MATERIAL AND METHODS Study area. The study was carried out in the coastal basins and drainages in the state of Maranhão, including a region between the Gurupi and Parnaíba river basins, in addition to the Tocantins River basin in the state (Fig. 1). The study area consists of 10 hydrographic basins, seven of which are state owned (Mearim, Itapecuru, Munim, Turiaçú, Maracaçumé, Preguiças and Periá basins) and three are federally owned (Parnaíba, Tocantins, Gurupi). Together, these occupy an area of ​​113,068.15 km2 (34.6% of the state of Maranhão) that is subdivided into three Brazilian hydrographic regions (Tocantins-Araguaia, Western Northeast Atlantic and Parnaíba) (MMA, 2006; NUGEO, 2016). ni.bio.br | scielo.br/ni Neotropical Ichthyology, 19(4): e210095, 2021 3/18 Cryptic speciation of the genus Aphyocharax Maranhão is the westernmost state in the Northeast Region of Brazil and borders the eastern side of Pará State in the North Region of the country. It has an area of ​​about 320,000 km2 and occupies about 3.9% of Brazil (Rebêlo et al., 2003). The state harbors three of the main Brazilian biomes, and transition ecotone areas between Amazonian tropical forests and open shrubby and dry forests of Cerrado and Caatinga. Therefore, this region is considered very important for ecological services and biodiversity conservation (Guimarães et al., 2018a). Ethical statement, specimen collection and preservation. Specimens selected for molecular data analysis (Tab. 1) were fixed and preserved in absolute ethanol. FIGURE 1 | Map of the sampling localities of Aphyocharax specimens in eastern Amazon coastal river drainages and surroundings in Brazil. Black circle = Aphyocharax brevicaudatus, Rio Maracaçumé/Maracaçumé/MA; orange circle = Aphyocharax sp. “Munim”, Riacho Fundo/Rio Munim/Chapadinha/MA; white circle = Aphyocharax sp. (Itapecuru), Riacho Primavera/Rio Itapecuru/Caxias/MA; green circle = Aphyocharax sp. (Itapecuru), Rio Saco/Rio Itapecuru/Codó/MA; yellow circle = Aphyocharax sp. (Mearim), Bacia 464/Rio Mearim/Arari/MA; blue circle = Aphyocharax sp. (Mearim), Rio Zutíua/Rio Pindaré/Rio Mearim/Pindaré-Mirim/MA; red circle = Aphyocharax sp. (Mearim), Rio Zutíua/Rio Pindaré/Rio Mearim/Pindaré-Mirim/MA; pink circle = Aphyocharax sp. (Mearim), Rio Pindaré/Rio Mearim/Bom Jesus das Selvas/ MA; salmon-pink circle = Aphyocharax avary, Rio Sororó/Rio Tocantins/Marabá/PA. 4/18 Neotropical Ichthyology, 19(4): e210095, 2021 ni.bio.br | scielo.br/ni Pâmella S.Brito, Erick C. Guimarães, Karen L.A. Guimarães, Luís R.R. Rodrigues, Marcelo R. Anjos, Axel M.Katz, Luis F. Carvalho-Costa and Felipe P. Ottoni DNA extraction, amplification, and sequencing. DNA extraction was carried out with a Wizard Genomic DNA Purification Kit (Promega) following the manufacturer’s protocol. The DNA quality was evaluated using 0.8% agarose gel electrophoresis stained with GelRed (Biotium). The DNA was stored at -20 °C until further procedures. The partial Cytochrome B mitochondrial gene (CytB) was amplified using standard PCR (polymerase chain reaction) and primers developed by Kocher et al. (1989) (L14841 5’ – AAATCAAAGCATAACACTGAAGATG – 3’) and Irwin et al. (1991) (H15915 5’ – CCAATTTGCATGGATGTCTTCTCGG – 3’). Amplification reactions were performed at a total volume of 15 μl comprising 10× buffer, 1.5 mM MgCl2, 400 μM dNTP, 0.2 μM of each primer, 1 U of Taq Polymerase (Invitrogen), 100 ηg of DNA template and ultrapure water. The amplification program consisted of a denaturation of 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 46–48 °C for 45 s, and 72 °C for 80 s, and an extension phase of 5 min at 72 °C. Amplicons were visualized using 1% agarose gel electrophoresis stained with GelRed (Biotium) and purified with Illustra GFX PCR DNA and a Gel Purification Kit (GE Healthcare). Samples were sequenced using both forward and reverse primers with a BigDye Terminator 3.1 Cycle Sequencing Kit in an ABI 3730 DNA Analyzer (Thermo Fisher Scientific). Data analyses. The dataset included the partial CytB (678 base pairs, bp) and sequences from other species of Aphyocharax and allied genera from the National Center for Biotechnology Information (NCBI) databases (Tab. 1). Sequences were aligned using ClustalW (Chenna et al., 2003) and translated into amino acid residues using the program MEGA 7 (Kumar et al., 2016) to test if the sequences came from NUMTs (nuclear mitochondrial DNA sequences), in which case premature stop codons or indels are expected. The best-fit evolutionary model (GTR+I+G) was selected using the Akaike information criterion (AIC) and jModelTest 2.1.7 (Darriba et al., 2012), and used in all analyses, except for Automatic Barcode Gap Discovery (ABGD). Species concept, species delimitation, and diagnoses. The unified species concept was adopted, considering that “species are (segments of) separately evolving metapopulation lineages” (de Queiroz, 2005, 2007). According to this concept, species are treated as hypothetical units that could be tested (detected) by applying distinct criteria (i.e., species delimitation methods), allowing for any method to independently provide evidence about species limits and identities (de Queiroz, 2005, 2007). Four distinct and independent single locus species delimitation methods relying on different operational criteria for species delimitation were implemented: ABGD, Automatic Barcode Gap Discovery (Puillandre et al., 2012); WP, a tree-based method proposed by Wiens, Penkrot (2002) (following Sites, Marshall, 2003); and two coalescentbased species delimitation methods termed bPTP, the Bayesian implementation of the Poisson tree processes (Zhang et al., 2013), and GMYC, the General Mixed Yule Coalescent method, single-threshold version (Fujisawa, Barraclough, 2013). All species delimitation methods were performed using the Cytb sequences, which is widely used for single locus species delimitation approaches (Avise, 2000). ni.bio.br | scielo.br/ni Neotropical Ichthyology, 19(4): e210095, 2021 5/18 Cryptic speciation of the genus Aphyocharax TABLE 1 | List of species, specimens and their respective GenBank sequence accession numbers. Sequences made available by this study are in bold. Species Catalog number Genbank accession Locality (Country/River/River drainage/Municipality/State) Aphyocharacidium bolivianum LBP 9055 HQ289710 Brazil/Arara/RO Aphyocharax anisitsi LBP 4750 JQ820081 Brazil Aphyocharax anisitsi LBP 3764 HQ289581 Brazil/Rio Negro/Aquidauana/MS Aphyocharax avary CICCAA02344.1 MK409660 Brazil/Rio Sororó/Rio Tocantins/Marabá/PA Aphyocharax avary CICCAA 02344.2 MZ558446 Brazil/Rio Sororó/Rio Tocantins/Marabá/PA Aphyocharax avary CICCAA02344.3 MK409661 Brazil/Rio Sororó/Rio Tocantins/Marabá/PA Aphyocharax brevicaudatus (female) CICCAA 02306 MK409668 Brazil/Rio Maracaçumé/Maracaçumé/MA Aphyocharax brevicaudatus (male) CICCAA 02308 MK409669 Brazil/Rio Maracaçumé/Maracaçumé/MA Aphyocharax brevicaudatus (male) CICCAA 02310 MK409670 Brazil/Rio Maracaçumé/Maracaçumé/MA Aphyocharax dentatus LBP 5112 JQ820082 Brazil/Rio Paraguai/Cáceres/MT Aphyocharax dentatus LBP 20 JQ820083 Brazil/Rio Paraguai/Rio Miranda/Corumbá/MT Aphyocharax cf. erythrurus LBP 15819 JQ820076 Venezuela Aphyocharax cf. erythrurus LBP 15820 JQ820077 Venezuela Aphyocharax nattereri LBP 3786 JQ820070 Brazil/Rio Paraguai/lagoa marginal do Rio Negro/Aquidauana/MS Aphyocharax nattereri LBP 3734 JQ820071 Brazil Aphyocharax pusillus LBP 23546 JQ820078 Brazil Aphyocharax pusillus LBP 4046 HQ289590 Brazil/Rio Moa/Cruzeiro do Sul/AC Aphyocharax rathbuni LBP 7608 JQ820079 Brazil/La Plata basin /Lagoa marginal do rio Cuiabá/Barão de Melgaço/MT Aphyocharax rathbuni LBP 8457 JQ820080 Brazil Aphyocharax sp. LBP 1587 HQ289533 Brazil/Rio das Garças/Rio Araguaia/Barra do Garças/MT Aphyocharax sp. LBP 2480 JQ820084 Brazil/Rio Araguaia/Aragarças/GO Aphyocharax sp. “Tapajós” CICCAA 04851.1 MZ558447 Brazil/Lago Papucu/Rio Tapajós/Santarém/PA Aphyocharax sp. “Tapajós” CICCAA 04851.3 MZ558448 Brazil/Lago Papucu/Rio Tapajós/Santarém/PA Aphyocharax sp. “Tapajós” CICCAA 04851.4 MZ558449 Brazil/Lago Papucu/Rio Tapajós/Santarém/PA Aphyocharax sp. “Tapajós” CICCAA 04851.6 MZ558450 Brazil/Lago Papucu/Rio Tapajós/Santarém/PA Aphyocharax sp. “Solimões” CICCAA 04836.1 MZ558451 Brazil/Ilha Cuera/Rio Solimões/Tefé/AM Aphyocharax sp. “Solimões” CICCAA 04836.3 MZ558452 Brazil/Ilha Cuera/Rio Solimões/Tefé/AM Aphyocharax sp. “Solimões” CICCAA 04840.1 MZ558453 Brazil/Lago Amanã/Rio Solimões/Maraã/AM Aphyocharax sp. “Solimões” CICCAA 04840.2 MZ5584534 Brazil/Lago Amanã/Rio Solimões/Maraã/AM Aphyocharax sp. “Solimões” CICCAA 04840.3 MZ5584535 Brazil/Lago Amanã/Rio Solimões/Maraã/AM Aphyocharax sp. “Mearim” CICCAA 02107.1 MZ558436 Brazil/Bacia 464/Rio Mearim/Arari/MA Aphyocharax sp. “Mearim” CICCAA 02107.2 MZ558437 Brazil/Bacia 464/Rio Mearim/Arari/MA Aphyocharax sp. “Mearim” CICCAA 02107.3 MZ558438 Brazil/Bacia 464/Rio Mearim/Arari/MA Aphyocharax sp. “Mearim” CICCAA 02107.4 MZ558439 Brazil/Bacia 464/Rio Mearim/Arari/MA 6/18 Neotropical Ichthyology, 19(4): e210095, 2021 ni.bio.br | scielo.br/ni Pâmella S.Brito, Erick C. Guimarães, Karen L.A. Guimarães, Luís R.R. Rodrigues, Marcelo R. Anjos, Axel M.Katz, Luis F. Carvalho-Costa and Felipe P. Ottoni TABLE 1 | (Continued) Species Catalog number Genbank accession Locality (Country/River/River drainage/Municipality/State) Aphyocharax sp. “Mearim” CICCAA 02107.5 MZ558440 Brazil/Bacia 464/Rio Mearim/Arari/MA Aphyocharax sp. “Pindaré” CICCAA 02320 MZ558441 Brazil/Igarapé Jenipapo/Rio Pindaré/Rio Mearim/Alto Alegre do Pindaré/MA Aphyocharax sp. “Pindaré” CICCAA 02323 MZ558442 Brazil/Rio Zutíua/Rio Pindaré/Rio Mearim/Pindaré-Mirim/MA Aphyocharax sp. “Pindaré” CICCAA 02033 MK409665 Brazil/Rio Pindaré/Rio Mearim/Bom Jesus das Selvas/MA Aphyocharax sp. “Itapecuru” CICCAA 02034 MK409666 Brazil/Riacho Primavera/Rio Itapecuru/Caxias/MA Aphyocharax sp. “Itapecuru” CICCAA 02357 MK409667 Brazil/Riacho Primavera/Rio Itapecuru/Caxias/MA Aphyocharax sp. “Itapecuru” CICCAA 02315.1 MZ558443 Brazil/Rio Saco/Rio Itapecuru/Codó/MA Aphyocharax sp. “Itapecuru” CICCAA 02315.2 MZ558444 Brazil/Rio Saco/Rio Itapecuru/Codó/MA Aphyocharax sp. “Itapecuru” CICCAA 02316 MZ558445 Brazil/Rio Saco/Rio Itapecuru/Codó/MA Aphyocharax sp. “Munim” CICCAA02345.1 MK409662 Brazil/Riacho Fundo/Rio Munim/Chapadinha/MA Aphyocharax sp. “Munim” CICCAA02345.2 MK409663 Brazil/Riacho Fundo/Rio Munim/Chapadinha/MA Aphyocharax sp. “Munim” CICCAA02345.3 MK409664 Brazil/Riacho Fundo/Rio Munim/Chapadinha/MA Prionobrama paraguayensis LBP 3230 JQ820073 Brazil/Lagoa marginal/Rio Cuiabazinho/Nobre/MT Prionobrama paraguayensis LBP 3230 JQ820072 Brazil/Lagoa marginal/Rio Cuiabazinho/Nobre/MT Prionobrama filigera LBP 4139 JQ820075 Brazil/Rio Juruá/Rio Moa/Mâncio Lima/AC Prionobrama filigera LBP 4139 JQ820074 Brazil/Rio Juruá/Rio Moa/Mâncio Lima/AC Leptagoniates steindachneri LBP 4137 HQ289600 Brazil/ Rio Moa/Mâncio Lima/AC Paragoniates alburnus LBP 9208 HQ289712 Venezuela/Rio Manapire/Cabruta/Guárico Phenagoniates macrolepis LBP 6105 HQ289678 Venezuela/Rio Apon Medio/Machiques de Perijá/Zulia Xenagoniates bondi LBP 3074 HQ289563 Venezuela/Rio Orinoco/Caicara del Orinoco/Bolivar Wiens and Penkrot analysis (WP). WP is based on the direct inspection of haplotype trees generated by a phylogenetic analysis with at least two individuals (haplotypes) of each focal species as terminals. In this method, the term “exclusive” is used instead of monophyletic since the term monophyly is considered inapplicable below the species level (Wiens, Penkrot, 2002). Clustered haplotypes with a concordant geographic distribution that form mutual and well supported clades (exclusive lineages) are strong evidence for species discrimination (absence of gene flow with other lineages). When haplotypes from the same locality fail to cluster together, there is potential evidence for gene flow with other populations (Wiens, Penkrot, 2002). Statistical support for the haplotypic tree was assessed by the posterior probability, with about 0.95 or higher considered significant (Alfaro, Holder, 2006). When only one haplotype (specimen) from one putative population was available, the species delimitation was based on the exclusivity of the sister clade of this single haplotype supported by significant values (Wiens, Penkrot, 2002). In addition, the method recognizes non-exclusive lineages as species since their sister clades are exclusive and supported by significant values (Wiens, Penkrot, 2002). ni.bio.br | scielo.br/ni Neotropical Ichthyology, 19(4): e210095, 2021 7/18 Cryptic speciation of the genus Aphyocharax A Bayesian inference (BI) phylogenetic tree was estimated with the software MrBayes 3.2 (Ronquist et al., 2012) to reconstruct the evolutionary relationships among terminals using the general time reversible (GTR+I+G) evolutionary model. The BI analysis was conducted with the following parameters: two independent Markov chain Monte Carlo (MCMC) runs of two chains each for 10 million generations, with a tree sampling frequency every 1,000 generations. The convergence of the MCMC chains and the proper burn-in value were assessed by evaluating the stationary phase of the chains using Tracer v. 1.6 (Rambaut et al., 2014). After removing the first 25% of the samples (burn-in), the final consensus tree and its posterior probabilities were generated with the remaining tree samples. The ingroup included species and populations with the morphotype and typical characters of A. avary in the eastern Amazon coastal river drainages and surroundings: Aphyocharax brevicaudatus (from the Maracaçumé River basin), A. avary (from the Tocantins River basin), Aphyocharax sp. “Itapecuru” (from the Itapecuru River basin), Aphyocharax sp. “Mearim” (from the Mearim River basin), and Aphyocharax sp. “Munim” (from the Munim River basin) (colored haplotypes in Fig. 2; Tab. 1). As the outgroup, we used sequences of Aphyocharacidium bolivianum Géry, 1973, Leptagoniates steindachneri Boulenger, 1887, Paragoniates alburnus Steindachner, 1876, Phenagoniates macrolepis (Meek & Hildebrand, 1913), Prionobrama filigera (Cope, 1870), Prionobrama paraguayensis (Eigenmann, 1914), Xenagoniates bondi Myers, 1942, and other species and populations of Aphyocharax (excluding those of the ingroup) (uncolored haplotypes in Fig. 2; Tab. 1). General Mixed Yule Coalescent (GMYC). The GMYC is a single locus coalescent-based species delimitation approach that relies on branch lengths to establish a threshold between speciation and coalescent processes (Fujisawa, Barraclough, 2013). Here we applied the single-threshold version of the method, which usually outperforms the multiple-threshold version (Fujisawa, Barraclough, 2013). A new dataset was created for this analysis, including only the ingroup (see WP section) and the clade with Aphyocharax cf. erythrurus, A. pusillus, Aphyocharax sp. “Solimões” + Aphyocharax sp. “Tapajós” (see Tab. 1) as the outgroup, which has the geographically closest populations to the ingroup. This new dataset was reduced to include only unique haplotypes using DAMBE5 (Xia, 2013) and the requirements of this method. The input ultrametric phylogenetic tree was made in BEAST v.1.8.4 (Drummond et al., 2012) with the following parameters: an uncorrelated relaxed clock with lognormal distribution, a Yule process as the tree prior with 10 million generations and sampling frequency of 1000. The GMYC analysis was performed using the Exelixis Lab’s server (https://species.h-its.org/gmyc/). We also performed a GMYC test analysis with the same parameters but included all the available species of Aphyocharax (see Fig. S1). Bayesian implementation of the Poisson tree processes (bPTP). The bPTP is another single locus coalescent-based species delimitation method, but it differs from other similar approaches, such as GMYC, since an ultrametric tree is not needed (not relying on branch lengths to delimit species), thus avoiding errors and computer intensive processes (Zhang et al., 2013). The method assumes that more molecular variability (number of nucleotide substitutions) is expected between haplotypes from 8/18 Neotropical Ichthyology, 19(4): e210095, 2021 ni.bio.br | scielo.br/ni Pâmella S.Brito, Erick C. Guimarães, Karen L.A. Guimarães, Luís R.R. Rodrigues, Marcelo R. Anjos, Axel M.Katz, Luis F. Carvalho-Costa and Felipe P. Ottoni different species than within a species (Zhang et al., 2013), establishing a threshold between speciation and coalescent processes. The reduced dataset for performing the bPTP was the same used in the GMYC, following the requirements of this method. The input phylogenetic tree was estimated with the software Mrbayes 3.2 (Ronquist et al., 2012) following the same parameters used in the WP. The bPTP analysis was performed using the Exelixis Lab’s web server (http://species.h-its.org/ptp/), following the default parameters except for a 20% burn-in. Aphyocharax cf. erythrurus was chosen as the outgroup since it is the most geographically distant species from the ingroup in this reduced dataset. We also performed a bPTP test analysis with the same parameters but included all the available species of Aphyocharax (see Fig. S2). Automatic Barcode Gap Discovery (ABGD). The ABGD is a barcode species delimitation method that aims to establish a minimum gap that probably corresponds to the threshold between interspecific and intraspecific processes (Puillandre et al., 2012). The major advantage of ABGD compared to the other barcode species delimitation methods is that the inference of the limit between interspecific and intraspecific processes (gap detection) is recursively applied to previously obtained groups to get finer partitions until there is no further partitioning, allowing a more refined search. Basically, the ABGD analysis indicates the number of groups (species) estimated relative to a large spectrum of p values (prior intraspecific values). For this, a 0.1 value assumes the maximum intraspecific variability, indicating that all sequences belong to only one species, and a 0.001 value assumes very low intraspecific variability, indicating that each distinct haplotype represents a different species. After running the ABGD, additional molecular, morphological, or ecological characters are needed to infer the correct number of species, following an integrative taxonomic perspective. The reduced dataset for performing the ABGD was the same used in the GMYC and bPTP. The analysis was conducted using the ABGD server website (https://bioinfo. mnhn.fr/abi/public/abgd/abgdweb.html) following the default parameters. RESULTS Phylogenetic analysis. The topology of our phylogenetic analysis (Fig. 2) recovered Aphyocharax as monophyletic but supported by a low posterior probability value (0.88), with A. nattereri as sister to all other Aphyocharax. However, all the other lineages sister to A. nattereri formed a large clade supported with the maximum posterior probability value (1) (Fig. 2). Within this large clade, three other clades formed: 1– comprising A. anisitsi, A. dentatus, A. rathbuni and a species not identified to the species level, but with low node support (0.59); 2– comprising Aphyocharax cf. erythrurus and several haplotypes considered here as A. pusillus, supported by the maximum support value (1); and 3– comprising our ingroup (populations occurring in the eastern Amazon coastal river drainages and surroundings, i.e., Aphyocharax brevicaudatus [from the Maracaçumé River basin], A. avary [from the Tocantins River basin], Aphyocharax sp. “Itapecuru” [from the Itapecuru River basin], Aphyocharax sp. “Mearim” [from the Mearim River basin] and Aphyocharax sp. “Munim” [from the Munim River basin]) supported by the maximum support value (1). The last two clades are probably sister ni.bio.br | scielo.br/ni Neotropical Ichthyology, 19(4): e210095, 2021 9/18 Cryptic speciation of the genus Aphyocharax groups; however, they are supported by low posterior probability (0.55) (Fig. 2). Species delimitation. WP. The BI phylogenetic analysis delimited five species within our ingroup: 1– Aphyocharax brevicaudatus (yellow colored); 2– A. avary (grey colored); 3–Aphyocharax sp. “Itapecuru” (blue colored); 4– Aphyocharax sp. “Mearim” (red colored); and 5– Aphyocharax sp. “Munim” (green colored). The haplotypes of each species formed exclusive clades with the maximum posterior probability value (1) (Fig. 2). FIGURE 2 | Bayesian inference phylogenetic tree used in the WP species delimitation method. Numbers above and below branches are posterior probability values. The colored haplotypes indicate the ingroup. Each group of haplotypes in the ingroup delimitated by WP as an exclusive lineage (species) has a different coloration. Species delimitated in our ingroup by WP: 1– Aphyocharax brevicaudatus (yellow colored); 2– A. avary (grey colored); 3– A. sp. “Itapecuru” (blue colored); 4– A. sp. “Mearim” (red colored); and 5– A. sp. “Munim” (green colored). 10/18 Neotropical Ichthyology, 19(4): e210095, 2021 ni.bio.br | scielo.br/ni Pâmella S.Brito, Erick C. Guimarães, Karen L.A. Guimarães, Luís R.R. Rodrigues, Marcelo R. Anjos, Axel M.Katz, Luis F. Carvalho-Costa and Felipe P. Ottoni GMYC and bPTP. Both single locus coalescent species delimitation methods delimited different lineages (species). The GMYC delimitated the following species: Aphyocharax brevicaudatus, A. avary, Aphyocharax sp. “Itapecuru,” Aphyocharax sp. “Mearim,” and Aphyocharax sp. “Munim” (Fig. 2). The bPTP delimitated the following species: Aphyocharax brevicaudatus, A. avary, and one single lineage including Aphyocharax sp. “Itapecuru” + Aphyocharax sp. “Mearim” + Aphyocharax sp. “Munim” (Fig. 3). ABDG. This method had two possible results. Result 1 delimited three species within our ingroup: Aphyocharax brevicaudatus, A. avary, and one single lineage including Aphyocharax sp. “Itapecuru” + Aphyocharax sp. “Mearim” + Aphyocharax sp. “Munim” (Fig. 3). These same three groups (species) were delimited between p values ranging from 0.0077 and 0.0028. Result 2 delimited five species within our ingroup: Aphyocharax brevicaudatus, A. avary, Aphyocharax sp. “Itapecuru,” Aphyocharax sp. “Mearim” and Aphyocharax sp. “Munim.” Initially, result 2 delimited the same groups as result 1, but a “recursive partition” later delimited the five groups listed above (Fig. 3) with a p value of 0.0017. FIGURE 3 | Ultrametric tree (Bayesian inference) including unique haplotypes summarizing the results of the GMYC, bPTP and ABGD (results 1 and 2). Numbers above and below branches are posterior probability values. Red values: posterior probabilities calculated by the software Beast; black values: posterior probabilities calculated by the software Mr. Bayes. Values below 50 are indicated as “- “. The stars indicate the ingroup. ni.bio.br | scielo.br/ni Neotropical Ichthyology, 19(4): e210095, 2021 11/18 Cryptic speciation of the genus Aphyocharax DISCUSSION Besides our phylogenetic approach to delimit lineages using species delimitation methods, we can state the following about the Aphyocharax phylogeny. The topology of our phylogenetic analysis (Fig. 2) recovered Aphyocharax as monophyletic but supported by a low posterior probability value - pp (0.88), with A. nattereri as sister to all other Aphyocharax species. The reason for the low support is probably because the fast evolutionary rate of Cytochrome b (Cytb) is more suitable for species delimitation or to reconstruct the relationships of closely related species (Avise, 2000). However, besides A. nattereri, the other remaining OTU form a robust clade supported by the maximum posterior probability value. The last clade also includes two smaller clades supported by low posterior probability values, which demonstrates that the gene used is not suitable for recovering older and the most basal branch and node relationships (Fig. 2). The first clade (pp = 0.59) includes A. rathbuni, A. anisitsi, a putative undescribed species (Aphyocharax sp.) and A. dentatus. The second clade (node support = 0.55) includes two other clades. Clade 1 comprises several haplotypes considered here as A. pusillus and Aphyocharax cf. erythrurus (with maximum node support). Clade 2 contains our ingroup (with maximum node support) that comprises species and populations occurring along the coastal river basins of the eastern Amazon region and surroundings: Aphyocharax brevicaudatus (from the Maracaçumé River basin), A. avary (from the Tocantins River basin), Aphyocharax sp. “Itapecuru” (from the Itapecuru River basin), Aphyocharax sp. “Mearim” (from the Mearim River basin) and Aphyocharax sp. “Munim” (from the Munim River basin) (colored haplotypes in Fig. 2; Tab. 1). The species and populations of the latter clade (colored clade) have the morphotype and typical character states of the type material of A. avary (as described and discussed by Brito et al., 2018), a species with an imprecise type locality in the Madeira River drainage of the Amazon River basin (Brito et al., 2018). Aphyocharax brevicaudatus is easily distinguished from the populations of our ingroup by unambiguous character states (see Brito et al., 2019). It is the most basal taxon in the ingroup clade. Aphyocharax avary was recovered as the sister group of all the other lineages from the coastal river basins in the eastern Amazon region. This clade has a moderate node support value (0.88). The monophyly of the lineages from these coastal river basins is supported by the maximum node support value (Fig. 2). Within this latter group, the lineage Aphyocharax sp. “Munim” is the sister group to the clade Aphyocharax sp. “Itapecuru” and Aphyocharax sp. “Mearim.” This last clade has a high node support value (0.98) (Fig. 2). The WP method recovered five lineages (i.e., species) in our ingroup that are all supported by the maximum node support value: 1– Aphyocharax brevicaudatus (yellow colored); 2– A. avary (grey colored); 3– Aphyocharax sp. “Itapecuru” (blue colored); 4– Aphyocharax sp. “Mearim” (red colored); and 5– Aphyocharax sp. “Munim” (green colored) (Fig. 2). Three of these lineages are possible undescribed cryptic species. Aphyocharax avary from the Tocantins River basin might be another one due to its disjunct geographical distribution to the type locality of A. avary. However, resolving this issue depends on the inclusion of haplotypes from the type locality of A. avary. Therefore, this species delimitation method recovered at least three undescribed species. The GMYC single-threshold version delimited the same lineages (i.e., species) as the 12/18 Neotropical Ichthyology, 19(4): e210095, 2021 ni.bio.br | scielo.br/ni Pâmella S.Brito, Erick C. Guimarães, Karen L.A. Guimarães, Luís R.R. Rodrigues, Marcelo R. Anjos, Axel M.Katz, Luis F. Carvalho-Costa and Felipe P. Ottoni WP (Fig. 3) in our ingroup. On the other hand, the bPTP delimited three lineages in our ingroup: Aphyocharax brevicaudatus, A. avary, and a single lineage including Aphyocharax sp. “Itapecuru” + Aphyocharax sp. “Mearim” + Aphyocharax sp. “Munim” (Fig. 3). Thus, according to the bPTP, we have at least one undescribed cryptic species in the region. The situation for Aphyocharax avary from the Tocantins River is the same here compared to the WP and GMYC. The ABGD analyses produced two possible results: one corroborating the same result from the bPTP (ABGD result 1) in our ingroup, and another (ABGD result 2) corroborating the results from the WP and GMYC analyses (Fig. 2) in our ingroup. Therefore, the number of species depends on the method used, although all of them pointed to undescribed cryptic species in the region. Some studies argue that in some cases GMYC can lead to an overestimation of the number of species (e.g., Talavera et al., 2013; García-Melo et al., 2019). Despite that in our study the GMYC analysis delimited the highest number of species, the results of this method were corroborated by the WP and ABGD result 2. Therefore, we cannot state that the GMYC analysis overestimated the number of delimited species in our study. Although molecular taxonomy studies involving fishes from the coastal river basins of the Eastern Amazon region are still scarce, some studies have been published in recent years, especially for the Characidae, which corroborate that this region has endemic characid species (e.g., Guimarães et al., 2018b, 2019, 2020b; Brito et al., 2019). Along with these studies, we show the usefulness of molecular approaches for revealing cryptic lineages (species) in the region and opportunities for new discoveries to enhance our knowledge of neotropical freshwater fishes. Based on our data obtained here, it is clear that the Cytb gene is very effective at delimiting lineages (species) due to its rapid evolutionary rate. Another conclusion is that there is one or more cryptic undescribed species of Aphyocharax, depending on the operational criterium used to delimit species, in the coastal river basins of the Eastern Amazon region. This is not limited to Aphyocharax, since other published and unpublished studies have found similar results for other characin groups (e.g., Guimarães et al., 2018b, 2019, 2020) and Characidae genera (E. C. Guimarães, 2021, pers. comm.). If similar approaches are applied, the same results might be found for other freshwater fish groups in the studied region. Thus, further studies using molecular approaches in the study area are needed to unravel hidden species and accurately estimate the freshwater fish diversity of the region. ACKNOWLEDGMENTS We are grateful to CAPES (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Finance Code 001) and FAPEMA (Fundação de Amparo à Pesquisa e ao Desenvolvimento Científico e Tecnológico do Maranhão) for providing the financial and infrastructure support to carry out this work. AMK thanks Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ: grant e–26/202.005/2020). Part of the examined material was collected by Elisabeth Henschel, which was funded by the National Geographic Society (Early Career Grant Number EC–316R–18). The English in this paper was reviewed by Nathan Smith. ni.bio.br | scielo.br/ni Neotropical Ichthyology, 19(4): e210095, 2021 13/18 Cryptic speciation of the genus Aphyocharax REFERENCES • Abell R, Thieme ML, Revenga C, Bryer M, Kottelat M, Bogutskaya N et al. Freshwater ecoregions of the world: a new map of biogeographic units for freshwater biodiversity conservation. BioScience 2008; 58(5):403–14. https://doi.org/10.1641/ B580507 • Abreu JMS, Craig JM, Albert JS, Piorski NM. Historical biogeography of fishes from coastal basins of Maranhão State, northeastern Brazil. Neotrop Ichthyol. 2019; 17(2):e180156. https://doi.org/10.1590/19820224-20180156 • Abreu JMS, Saraiva AC, Albert JS, Piorski NM. Paleogeographic influences on freshwater fish distributions in northeastern Brazil. J South Am Earth Sci. 2020; 102(2020):102692. https://doi. org/10.1016/j.jsames.2020.102692 • Alfaro ME, Holder MT. The posterior and the prior in Bayesian phylogenetics. Annu Rev Ecol Evol Syst. 2006; 37(1):19– 42. https://doi.org/10.1146/annurev. ecolsys.37.091305.110021 • Adams M, Raadik TA, Burridge CP, Georges A. Global biodiversity assessment and hyper-cryptic species complexes: more than one species of elephant in the room? Syst Biol. 2014; 63(4):518–33. https://doi. org/10.1093/sysbio/syu017 • Avise JC. Phylogeography: the history on formation of species. Cambridge: University Press; 2000. • Barros MC, Fraga EC, Birindelli JLO. Fishes from the Itapecuru River basin, State of Maranhão, northeast Brazil. Braz J Biol. 2011; 71(2):375–80. https://doi.org/10.1590/ S1519-69842011000300006 • Betancur-R. R, Arcila D, Vari RP, Hughes LC, Oliveira C, Sabaj MH et al. Phylogenomic incongruence, hypothesis testing, and taxonomic sampling: the monophyly of Characiform fishes. Evolution. 2018; 73(2):329–45. https://doi. org/10.1111/evo.13649 • Bickford D, Lohman DJ, Sodhi NS, NG PKL, Meier R, Winker K et al. Cryptic species as a window on diversity and conservation. Trends Ecol Evol. 2006; 22(3):148–55. https://doi.org/10.1016/j. tree.2006.11.004 14/18 Neotropical Ichthyology, 19(4): e210095, 2021 • Brito PS, Guimarães EC, Katz AM, Piorski NM, Ottoni FP. Taxonomic status of Aphyocharax avary Fowler, 1913, Aphyocharax pusillus Günther, 1868 and Chirodon alburnus Günther, 1869 (Characiformes, Characidae). Zoosyst Evol. 2018; 94(2):393–99. https://doi.org/10.3897/ zse.94.28201 • Brito PS, Guimarães EC, CarvalhoCosta LF, Ottoni FP. A new species of Aphyocharax Günther, 1868 (Characiformes, Characidae) from the Maracaçumé River basin, eastern Amazon. Zoosyst Evol. 2019; 95(2):507–16. https://doi. org/10.3897/zse.95.36788 • Buckup PA, Menezes NA, Ghazzi MS. Catálogo das espécies de peixes de água doce do Brasil. Rio de Janeiro: Museu Nacional; 2007. • Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG et al. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 2003; 31(13):3497–500. https://doi.org/10.1093/ nar/gkg500 • Close B, Banister K, Baumans V, Bernoth EM, Bromage N, Bunyan J et al. Recommendations for euthanasia of experimental animals: Part 1. Lab Anim. 1996; 30(4):293–316. https://doi. org/10.1258/002367796780739871 • Close B, Banister K, Baumans V, Bernoth EM, Bromage N, Bunyan J et al. Recommendations for euthanasia of experimental animals: Part 2. Lab Anim. 1997; 31(1):1–32. https://doi. org/10.1258/002367797780600297 • Corrêa CE, Hahn NS, Delariva RL. Extreme trophic segregation between sympatric fish species: the case of small sized body Aphyocharax in the Brazilian Pantanal. Hydrobiologia. 2009; 635(1):57– 65. https://doi.org/10.1007/s10750-009-98612 • Dagosta FCP, de Pinna M. The fishes of the amazon: distribution and biogeographical patterns, with a comprehensive list of species. Bull Am Mus Nat Hist. 2019; 431:1–163. http://digitallibrary.amnh.org/ handle/2246/6940 ni.bio.br | scielo.br/ni Pâmella S.Brito, Erick C. Guimarães, Karen L.A. Guimarães, Luís R.R. Rodrigues, Marcelo R. Anjos, Axel M.Katz, Luis F. Carvalho-Costa and Felipe P. Ottoni • Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models, new heuristics and parallel computing. Nat Methods. 2012; 9(8):772. https://doi. org/10.1038/nmeth.2109 • Drummond AJ, Suchard MA, Xie D, Rambaut A. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol Biol Evol. 2012; 29(8):1969–73. https://doi.org/10.1093/ molbev/mss075 • Fowler HW. Fishes from the Madeira River, Brazil. Proc Acad Nat Sci Philadelphia. 1913; 65:517–79. • Fujisawa T, Barraclough TG. Delimiting species using single–locus data and the Generalized Mixed Yule Coalescent approach: a revised method and evaluation on simulated data sets. Syst Biol. 2013; 62(5):707–24. https://doi.org/10.1093/sysbio/ syt033 • García-Melo JE, Oliveira C, Da Costa Silva GJ, Ochoa-Orrego LE, Garcia Pereira LH, Maldonado-Ocampo JA. Species delimitation of neotropical Characins (Stevardiinae): Implications for taxonomy of complex groups. PLoS ONE. 2019; 14(6):e0216786. https://doi.org/10.1371/ journal.pone.0216786 • Gonçalves TK, Azevedo MA, Malabarba LR, Fialho CB. Reproductive biology and development of sexually dimorphic structures in Aphyocharax anisitsi (Ostariophysi: Characidae). Neotrop Ichthyol. 2005; 3(3):433–38. https://doi. org/10.1590/S1679-62252005000300012 • Guimarães EC, Brito PS, Ferreira BRA, Ottoni FP. A new species of Charax (Ostariophysi, Characiformes, Characidae) from northeastern Brazil. Zoosyst Evol. 2018a; 94(1):83–93. https://doi.org/10.3897/ zse.94.22106 • Guimarães EC, De Brito PS, Feitosa LM, Carvalho-Costa LF, Ottoni FP. A new species of Hyphessobrycon Durbin from northeastern Brazil: evidence from morphological data and DNA barcoding (Characiformes, Characidae). ZooKeys. 2018b; 765:79–101. https://doi.org/10.3897/ zookeys.765.23157 • Guimarães EC, De Brito PS, Feitosa LM, Carvalho-Costa LF, Ottoni FP. A new cryptic species of Hyphessobrycon Durbin, 1908 (Characiformes, Characidae) from the Eastern Amazon, revealed by integrative taxonomy. Zoosyst Evol. 2019; 95(2):345–60. https://doi.org/10.3897/zse.95.34069 ni.bio.br | scielo.br/ni • Guimarães EC, Brito PS, Gonçalves CS, Ottoni FP. An inventory of Ichthyofauna of the Pindaré River drainage, Mearim River basin, Northeastern Brazil. Bio Neotrop. 2020a; 20(4):e20201023. https://doi. org/10.1590/1676-0611-BN-2020-1023 • Guimarães EC, Brito PS, Bragança PHN, Santos JP, Katz AM, Carvalho Costa LF et al. Integrative taxonomy reveals two new cryptic species of Hyphessobrycon Durbin, 1908 (Teleostei: Characidae) from the Maracaçumé and middle Tocantins River basins, Eastern Amazon region. Eur J Taxon. 2020b; 723(1):77–107. https://doi. org/10.5852/ejt.2020.723.1145 • Goldstein PZ, DeSalle R. Integrating DNA barcode data and taxonomic practice: determination, discovery, and description. BioEssays 2010; 33(2):135–47. https://doi. org/10.1002/bies.201000036 • Hubert N, Renno JF. Historical biogeography of South American freshwater fishes. J Biogeogr. 2006; 33(8):1414–36. https://doi.org/10.1111/ j.1365-2699.2006.01518.x • Irwin DM, Kocher TD, Wilson AC. Evolution of the cytochrome b gene of mammals. J Mol Evol. 1991; 32(2):128–44. https://doi.org/10.1007/BF02515385 • Kocher TD, Thomas WK, Meyer A, Edwards SV, Pääbo S, Villablanca FX et al. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. PNAS USA. 1989; 86(16):6196–200. https://doi. org/10.1073/pnas.86.16.6196 • Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016; 33(7):1870–74. https://doi. org/10.1093/molbev/msw054 • Leary S, Underwood W, Anthony R, Cartner S, Corey D, Grandin T. AVMA Guidelines for the euthanasia of animals. 2013. Available from: http://works.bepress. com/cheryl_greenacre/14 [accessed 31 Mar 2020]. • Lima FCT, Pires THS, Ohara WM, Jerep FC, Carvalho FR, Marinho MMF et al. Characidae. In: Queiroz LJ, TorrenteVilara G, Ohara WM, Pires THS, Zuanon J, Dória CRC, editors. Peixes do rio Madeira. São Paulo: Dialeto Latin American Documentary; 2013. p.213–395. Neotropical Ichthyology, 19(4): e210095, 2021 15/18 Cryptic speciation of the genus Aphyocharax • Ministério do Meio Ambiente (MMA). Caderno da região hidrográfica Atlântico nordeste ocidental. Brasília: MMA, Secretária de Recursos Hídricos. 2006; p.128. • Mirande JM. Morphology, molecules and the phylogeny of Characidae (Teleostei, Characiformes). Cladistics. 2018; 35(3):282– 300. https://doi.org/10.1111/cla.12345 • NUGEO. Bacias hidrográficas e climatologia no Maranhão. São Luís: Universidade Estadual do Maranhão, Núcleo Geoambinetal. 2016; p.165. • Ochoa LE, Melo BF, García-Melo JE, Maldonado-Ocampo JA, Souza CS, Alnornoz-Garzón JG et al. Species delimitation reveals an underestimated diversity of Andean catfishes of the family Astroblepidae (Teleostei: Siluriformes). Neotrop Ichthyol. 2020; 18(4):e200048. https://doi.org/10.1590/1982-0224-2020-0048 • Ohara WM, Lima FCT, Salvador GN, Andrade MC. Peixes do rio Teles Pires: Diversidade e guia de identificação. Aparecida de Goiânia: Gráfica Amazonas e Editora Ltda; 2017. • Oliveira C, Avelino GS, Abe KT, Mariguela TC, Benine RC, Ortí G, Vari RP, Castro RMC. Phylogenetic relationships within the speciose family Characidae (Teleostei: Ostariophysi: Characiformes) based on multilocus analysis and extensive ingroup sampling. BMC Evol Biol. 2011; 11:275. https://doi.org/10.1186/1471-2148-11-275 • Ottoni FP, Mattos JLO, Katz AM, Bragança PHN. Phylogeny and species delimitation based on molecular approaches on the species of the Australoheros autrani group (Teleostei, Cichlidae), with biogeographic comments. Zoosyst Evol. 2019; 95(1):49–64. https://doi.org/10.3897/zse.95.31658 • Pante E, Schoelinck C, Puillandre N. From intregative taxonomy to species description: one step beyond. Syst Biol. 2015; 64(1):152–60. https://doi.org/10.1093/ sysbio/syu083 • Puillandre N, Lambert A, Brouillet S, Achaz G. ABGD, automatic barcode gap discovery for primary species delimitation. Mol Ecol. 2012; 21(8):1864–77. https://doi. org/10.1111/j.1365-294X.2011.05239.x • de Queiroz K. Different species problems and their resolution. BioEssays 2005; 27(12):1263–69. https://doi.org/10.1002/ bies.20325 16/18 Neotropical Ichthyology, 19(4): e210095, 2021 • de Queiroz K. Species concepts and species delimitation. Syst Biol. 2007; 56(6):879–86. https://doi.org/10.1080/10635150701701083 • Rambaut A, Suchard M, Xie D, Drummond A. Tracer v1.6. 2014. Available from: http://beast.bio.ed.ac.uk/Tracer • Rebêlo J, Rêgo M, Albuquerque P. Abelhas (Hymenoptera, Apoidea) da região setentrional do Estado do Maranhão, Brasil. In: Melo GAR, Santos IA, editors. Apoidea Neotropical: Homenagem aos 90 anos de Jesus Santiago Moure. UNESC; 2003. p.265–78. • Ronquist F, Teslenko M, Van der Mark P, Ayres DL, Darling A, Höhna S et al. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol. 2012; 61(3):539–42. https://doi.org/10.1093/sysbio/ sys029 • Sites JW, Jr., Marshall JC. Delimiting species: a renaissance issue in systematic biology. Trends Ecol. Evol. 2003; 18(9):462–70. https://doi.org/10.1016/S01695347(03)00184-8 • Souza CS, Costa-Silva GJ, Roxo FF, Foresti F, Oliveira C. Genetic and morphological analyses demonstrate that Schizolecis guntheri (Siluriformes: Loricariidae) is likely to be a species complex. Front Genet. 2018; 9:69. https://doi.org/10.3389/ fgene.2018.00069 • Souza CS, Silva GSC, Ochoa LE, Roxo FF, Costa-Silva GJ, Foresti F, Melo BF, Oliveira C. Molecular and morphological diversity in species of Kronichthys (Teleostei, Loricariidae) from Atlantic coastal rivers of Brazil. J Fish Biol. 2020; 98(3):668–79. https://doi.org/10.1111/ jfb.14607 • Souza IL, Moreira-Filho O, Bertollo LAC. Karyotypic characterization of Aphyocharax diffificilis (Pisces, Characidae): C-banding, Ag-NORs and occurrence of diplochromosomes. Cytobios. 1995; 83:33– 39. • Souza-Lima R. The subfamily Aphyocharacinae. In: Reis RE, Kullander SE, Ferraris Jr., CJ, editors. Check list of the freshwater fishes of South and Central America. Porto Alegre: Edipucrs; 2003. p.197–99. ni.bio.br | scielo.br/ni Pâmella S.Brito, Erick C. Guimarães, Karen L.A. Guimarães, Luís R.R. Rodrigues, Marcelo R. Anjos, Axel M.Katz, Luis F. Carvalho-Costa and Felipe P. Ottoni • Tagliacollo VA, Souza-Lima R, Benine RC, Oliveira C. Molecular phylogeny of Aphyocharacinae (Characiformes, Characidae) with morphological diagnoses for the subfamily and recognized genera. Mol Phylogenet Evol. 2012; 64(2):297–307. https://doi.org/10.1016/j.ympev.2012.04.007 • Taphorn DC, Thomerson JE. Un characido nuevo, Aphyocharax colifax, de las cuencas de los rios Caroni y Caura en Venezuela. Rev Unellez de Ciencia y Tecnología. 1991; 4(1–2):113–15. • Talavera G, Dincã V, Vila R. Factors affecting species delimitations with the GMYC model: insights from a butterfly survey. Methods Ecol Evol. 2013; 4(12):1101–10. https://doi.org/10.1111/2041210X.12107 • Terán GE, Alonso F, Aguilera G, Mirande JM. First record of Aphyocharax anisitsi Eigenmann & Kennedy, 1903 in the upper Bermejo River basin, northwestern Argentina. Ichthyol Cont of PecesCriollos. 2016; 44:1–04. • Wiens JJ, Penkrot TA. Delimiting species using DNA and morphological variation and discordant species limitsin spiny lizards (Sceloporus). Syst Biol. 2002; 51(1):69–91. https://doi. org/10.1080/106351502753475880 • Willink PW, Chernoff B, MachadoAllison A, Provenzano F, Petry P. Aphyocharax yekwanae, a new species of bloodfin tetra (Teleostei: Characiformes: Characidae) from the Guyana Shield of Venezuela. Ichthyol Explor Freshw. 2003; 14(1):1–08. • Xia XH. Dambe5: a comprehensive software package for data analysis in molecular biology and evolution. Mol Biol Evol. 2013; 30(7):1720–28. https://doi. org/10.1093/molbev/mst064 • Zhang J, Kapli P, Pavlidis P, Stamatakis A. A general species delimitation method with applications to phylogenetic placements. Bioinformatics 2013; 29(22):2869–76. https://doi.org/10.1093/ bioinformatics/btt499 AUTHORS’ CONTRIBUTION Pâmella Silva de Brito: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing-original draft, Writing-review and editing. Erick Cristofore Guimarães: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing-original draft, Writing-review and editing. Karen Larissa Auzier Guimarães: Formal analysis, Investigation, Methodology, Writing-original draft, Writing-review and editing. Luís Reginaldo Ribeiro Rodrigues: Formal analysis, Investigation, Methodology, Writing-original draft, Writing-review and editing. Marcelo Rodrigues dos Anjos: Conceptualization, Data curation, Writing-original draft, Writing-review and editing. Axel Makay Katz: Formal analysis, Investigation, Methodology, Writing-original draft, Writing-review and editing. Luis Fernando Carvalho-Costa: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Writing-original draft, Writing-review and editing. Felipe Polivanov Ottoni: Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Software, Supervision, Validation, Visualization, Writing-original draft, Writing-review and editing. ETHICAL STATEMENTS Individuals collected for this study were euthanized with a buffered solution of Tricaine methanesulfonate MS–222 (250 mg/L) for 10 min or more, until the opercular movements completely ceased, according to ni.bio.br | scielo.br/ni Neotropical Ichthyology, 19(4): e210095, 2021 17/18 Cryptic speciation of the genus Aphyocharax animal welfare laws and guidelines (Close et al., 1996, 1997; Leary et al., 2013). Sampling was authorized by IBAMA and SISBIO through the documents Nº 02001.007241/2004–37 and Nº 42415, respectively. COMPETING INTERESTS The authors declare no competing interests. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. Distributed under Creative Commons CC-BY 4.0 © 2021 The Authors. Diversity and Distributions Published by SBI HOW TO CITE THIS ARTICLE • Brito PS, Guimarães EC, Guimarães KLA, Rodrigues LRR, Anjos MR, Katz AM, Carvalho-Costa LF, Ottoni FP. Cryptic speciation in populations of the genus Aphyocharax (Characiformes: Characidae) from eastern Amazon coastal river drainages and surroundings revealed by single locus species delimitation methods. Neotrop Ichthyol. 2021; 19(4):e210095. https://doi.org/10.1590/1982-0224-2021-0095 18/18 View publication stats Neotropical Ichthyology, 19(4): e210095, 2021 ni.bio.br | scielo.br/ni